Phytophthora borealis Hansen et al. (ATCC® MYA-4881)

Strain Designations: AKWA58.1-0708 [CBS 132023]  /  Product Format: frozen

Classification Peronosporaceae, Phytophthora, borealis
Strain Designations AKWA58.1-0708 [CBS 132023]
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Comments
Plant pathogen
Morphology After 5 days on V8 juice medium at 20°C colonies are angular and petaloid with hyphae appressed. After 3 weeks sporangia are persistent. Sporangia ovoid or obpyriform.  Oogonia absent.
Sequenced Data
GenBank accession number: JQ745261

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTATCAACCCCTTAAATTTGGGGGCTTGCTCGGCGGCGTGCGTGCTGGCCTGTAATGGGTCGGCGTGYTGCTGCTGGGCGGGCTCTATCATGGGCGAGCGTTTGGGCTTCGGCTCGAGCTAGTAGCTATCAATTTTAAACCCCTTCTTAAATACTGAACATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCTGGCGGTCTTTCGAGTCTGCCGGTGAGTCCTTTGAAATGTACTGAACTGTACTCTCTCTTTGCTCGAAAAGCGTGGCGTTGCTGGTTGTGGAGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTTASCTGTGGCGTTTAATGGAGGAGTGTTYGATTCGCGGTATGGTTGGCTTCGGCTGAACAATCTGCTTATTGGGTGCTTTTCCTGTCATTGGCGGTACGAACTGGTGAACCGTAGCTGTGTGGTGCTTGGCTTTTGAACCGGCTTTGCTTTGCGAAGTAGGGTGGCGGCTTCGGCTGTCGAGGGGTCGATCCATTTTGGGAAACTTTGTGTGTGCGGCTTCGTGCTGCGCGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG

GenBank accession number: JQ745268

Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGCGCGTGCGCTGTGGCAGCGGCTTTTTTGGCTGCGCTCGGTGCGTGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 5 days on V8 juice medium at 20°C colonies are angular and petaloid with hyphae appressed. After 3 weeks sporangia are persistent. Sporangia ovoid or obpyriform.  Oogonia absent.
Name of Depositor E Hansen
Special Collection ATCC
Chain of Custody
ATCC <-- E Hansen <-- P Reeser
Isolation
Forest streams, Bear Creek, Alaska, USA
Cross References

Nucleotide (GenBank) : JQ745261 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ745268 D1/D2 region of 28S rRNA gene.

References

Hansen EM, et al. Phytophthora borealis and Phytophthora riparia, new species in Phytophthora ITS clade 6. Mycologia 104: 1133-1142. PubMed: 22778166