Phytophthora borealis Hansen et al. (ATCC® MYA-4881)

Strain Designations: AKWA58.1-0708 [CBS 132023]  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Peronosporaceae, Phytophthora, borealis
Strain Designations AKWA58.1-0708 [CBS 132023]
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Comments
Plant pathogen
Morphology After 5 days on V8 juice medium at 20°C colonies are angular and petaloid with hyphae appressed. After 3 weeks sporangia are persistent. Sporangia ovoid or obpyriform.  Oogonia absent.
Sequenced Data
GenBank accession number: JQ745261

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGTAGGTGAACCTGCGGAAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTATCAACCCCTTAAATTTGGGGGCTTGCTCGGCGGCGTGCGTGCTGGCCTGTAATGGGTCGGCGTGYTGCTGCTGGGCGGGCTCTATCATGGGCGAGCGTTTGGGCTTCGGCTCGAGCTAGTAGCTATCAATTTTAAACCCCTTCTTAAATACTGAACATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCTGGCGGTCTTTCGAGTCTGCCGGTGAGTCCTTTGAAATGTACTGAACTGTACTCTCTCTTTGCTCGAAAAGCGTGGCGTTGCTGGTTGTGGAGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTTASCTGTGGCGTTTAATGGAGGAGTGTTYGATTCGCGGTATGGTTGGCTTCGGCTGAACAATCTGCTTATTGGGTGCTTTTCCTGTCATTGGCGGTACGAACTGGTGAACCGTAGCTGTGTGGTGCTTGGCTTTTGAACCGGCTTTGCTTTGCGAAGTAGGGTGGCGGCTTCGGCTGTCGAGGGGTCGATCCATTTTGGGAAACTTTGTGTGTGCGGCTTCGTGCTGCGCGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG

GenBank accession number: JQ745268

Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGCGCGTGCGCTGTGGCAGCGGCTTTTTTGGCTGCGCTCGGTGCGTGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 5 days on V8 juice medium at 20°C colonies are angular and petaloid with hyphae appressed. After 3 weeks sporangia are persistent. Sporangia ovoid or obpyriform.  Oogonia absent.
Name of Depositor E Hansen
Special Collection ATCC
Chain of Custody
ATCC <-- E Hansen <-- P Reeser
Isolation
Forest streams, Bear Creek, Alaska, USA
Cross References

Nucleotide (GenBank) : JQ745261 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ745268 D1/D2 region of 28S rRNA gene.

References

Hansen EM, et al. Phytophthora borealis and Phytophthora riparia, new species in Phytophthora ITS clade 6. Mycologia 104: 1133-1142. PubMed: 22778166

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation