Candida takata Lee (ATCC® MYA-4702)

Strain Designations: EN25S01 [CBS 12244, BCRC 23240]  /  Product Format: frozen

Strain Designations EN25S01 [CBS 12244, BCRC 23240]
Application
Ferments glucose
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain yes
Preceptrol® no
Morphology On YM medium at 25°C after 7 days, colonies creamy white to beige, smooth, with entire margin. Cells globose to ellipsoidal, smooth, small cells 3-3.75 µm x 1.5-3 µm, large cells 4.5-7.5 µm x 4.5-6 µm. Pseudohyphae present.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTAAAGTATTCTTCAGGCAGCCAGCGCTTCCACAGCGCGGCCGCCTAAACCTTACACACTGTGATTAGTTTTTTTATCATTGCTTTGGCTTGGGGTAACCCGGCCGAAGGTTTTAAACACAAAGATTTTATCTTTTTCTTTTAAACATCAGTCAACGAAGTTTTAAACTATAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGGTTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCCTCGGGTTTGGTATTGAGTGATACTCTGTCCAGGGTTAACTTGAAATAGTGAATTGGCAAGAGTGTGCTTCTGCGGCCTCTTGACTGAGATAATGTATTAGGTTCTACCAACTCGTTATAGCGGTCTAGAAAGTCCAGGCGGCATATTGAGCTCGGCCCAACAACCACCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene.

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCCTCGGTGCCCGAGTTGTAATTTGAAGATAGTTTTCTGGCACTGGCCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTCTGGCGGGGAGTCCAGTGCTTTGTAGATTTCTATCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTCGATCAGACTTGGTGTTTTGTGATTATCTTCCCTTCTTGGGTTGTGCACTCGCATTTCACTGGGCCAGCATCGGTTCGGGTGGCAAGATAATGACATTGGAACGTGGCACCTTCTTCGGATGGTGTGTTATAGCCCTTGTTGATGTTGCCTGCCTGGACCGAGGACTGCGGCTTCTGCCTAGGATGCTGGCGTAATGATCCAATACCG

Morphology On YM medium at 25°C after 7 days, colonies creamy white to beige, smooth, with entire margin. Cells globose to ellipsoidal, smooth, small cells 3-3.75 µm x 1.5-3 µm, large cells 4.5-7.5 µm x 4.5-6 µm. Pseudohyphae present.
Name of Depositor CF Lee
Special Collection ATCC
Chain of Custody
ATCC <-- CF Lee
Isolation
Soil, Sinyi, Nantou, Taiwan
Cross References

Nucleotide (GenBank) : JQ906769 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906764 D1/D2 region of 28S rRNA gene

References

Chang CF, et al. Five novel species of the anamorphic genus Candida in the Cyberlindnera clade isolated from natural substrates in Taiwan. Antonie van Leeuwenhoek 102: 9-21, 2012. PubMed: 22331448