Malassezia restricta E. Guého, J. Guillot et Midgley (ATCC® MYA-4611)

Strain Designations: CBS 7877 [ATCC 96810, JCM 14890, RA 42.2C, NBRC 103918]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 7877 [ATCC 96810, JCM 14890, RA 42.2C, NBRC 103918]
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Lipophilic or lipid-dependent yeasts.
Genome sequencing strain (The Procter & Gamble Company, USA).
Opportunistic pathogen that can cause systematic infection in neonates and are associated with multiple human skin disorders.
Medium ATCC® Medium 2693: modified Dixon (mDixon)
ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
ITS DNA sequence of MYA-4611

CAAGGTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAAGATTTGGGCAGGCCATACGGACGCCAAAAAGTGTCCCTGGCCGCCTACACCCACTATACATCCACAAACCCGTGTGCACTGTCTTGGAGAAAGGCTTCAGAGAAGTTTTTTGTGGCCTCTCTTGGGGTCTTTCTTCGCTACAAACTCGAATGGTTAGTATGAACGTGGAACTTGGTTGGACCGTCACTGGCCAACAAACTATACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTATGGCAATCCGTAGAGCATGCCTGTTTGAGTGCCATGAAATCTCCCACCCCAAGCGGTTTTTACATGAAACGGCTTGGCGGATGGGGTCTGGATGGGTGCCTCTGCCTGCGCTACCTAGCACAGGCTCGCCCGAAATGCATGAGCGCCTTGAGACACTTTGCATCCGCCTCTCTGTTTGGGAGGAGGCGGCCAAGCAGTGTTTTTCTCCTGGCATGGCATGATACGTCATTTGCTATGTCGCCTAAAGGAGGAATGTTTGGTTGTGTCTGCGTGTGCTTCGAACTTGCCTCTGTGGCACATCCCAATT


D1D2 DNA sequence of MYA-4611

ATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCGTCTTCGGCGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAACAGGGCATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGAAGTACCGTGCTTTGTGATACACGCTCCAAGAGTCGAGTAGTTTGGGATTGCTGCTCAAAGTGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCACTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTGGCTTTTGCTTGGTGTATTTCTCGGTAGCAAGCCAGCATTGGTTTGTGTCGTCGGAGAAGCGTATGGGGAATGTGGCATCCTCGGATGTGTTATAGCCCTGTGCAGGATACGACGACGTAGACCAAGGAACGCAGTGTGCCCTCTGGGCGGGTCTTCGGACACCTTCACACTTAGGA

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Skin of man, Bristol State, UK.
Cross References

Nucleotide (GenBank) : GU291286 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : GU291270 ITS including 5.8S rRNA gene

References

Gueho E, Midgley G, Guillot J. The genus Malassezia with description of four new species. Antonie van Leeuwenhoek 69: 337-355, 1996. PubMed: 8836432

Xu J, et al. Dandruff-associated Malassezia genomes reveal convergent and divergent virulence traits shared with plant and human fungal pathogens. Proc. Natl. Acad. Sci. USA 104: 18730-18735, 2007. PubMed: 18000048

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation