Advanced Search

Candida albicans (Robin) Berkhout (ATCC® 11651™)

Strain Designations: 171D  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 171D
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Effects of yeast cells on virulence for mice
Morphology and physiology of strain sectors
response to light
Morphology Colonies on YM agar at 25°C after 5 days cream-coloured, smooth, dull, dome-shaped, with a mycelial border. Yeast like cells globose to ovoidal, thin walled, hyaline and occur single in pairs and clusters.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGCAACGTCTACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC
Morphology Colonies on YM agar at 25°C after 5 days cream-coloured, smooth, dull, dome-shaped, with a mycelial border. Yeast like cells globose to ovoidal, thin walled, hyaline and occur single in pairs and clusters.
Name of Depositor GH Scherr
Chain of Custody
ATCC <-- GH Scherr <-- M. Hotchkiss <-- F. Spindle
Isolation
Lung pus, Virginia
Cross References

Nucleotide (GenBank) : KP780440 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KP780462 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : J04230 C.albicans thymidylate synthase (Ts) gene, complete cds.

References

Saltarelli CG, Coppola CP. Effect of light on growth and metabolite synthesis in Candida albicans. Mycologia 71: 773-785, 1979.

Saltarelli CG. Morphological and physiological variations between sectors isolated from giant colonies of Candida albicans and C. stellatoidea. Mycopathol Mycol Appl 34: 209-220, 1968.

Singer SC, et al. Cloning, purification, and properties of Candida albicans thymidylate synthase. J Bacteriol 171: 1372-1378, 1989.

Scherr GH. The use of yeast cells to enhance the virulence of Candida albicans for mice. Mycopathol Mycol Appl 6: 260-289, 1953.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS