Quantitative Synthetic Hepatitis A virus DNA (ATCC® VR-3257SD)

Product Format: frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica DNAstable

Permits and Restrictions

View Permits

Agent Quantitative Synthetic Hepatitis A virus DNA
Common Name HAV
Applications ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation, and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica DNAstable
Storage Conditions -20°C or colder
Intended Use The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.

Biomatrica Logo
Comments Manufactured under ISO 13485 guidance

Preparation includes genomic segments from the 5’ untranslated region, viral capsid proteins (VP1- 4), self-cleaving peptide 2A, proteinase 3C, and 3D RNA polymerase.

The following primers and probe can be used with this nucleic acid preparation

RefCosta-Mattioli M, et al. Quantification and duration of viraemia during hepatitis A infection as determined by real-time RT-PCR. J Viral Hepat 9(2): 101-106, 2002. PubMed: 11876791:
Forward primer: TTTCCGGAGCCCCTCTTG
Reverse primer: AAAGGGAAATTTAGCCTATAGCC
Probe: FAM-ACTTGATACCTCACCGCCGTTTGCCT-TAMRA
Name of Depositor ATCC
Special Collection DNA
References

Coudray-Meunier C, et al. Discrimination of infectious hepatitis A virus and rotavirus by combining dyes and surfactants with RT-qPCR. BMC Microbiol 13: 216, 2013. PubMed: 24083486

Coudray-Meunier C, et al. Hepatitis A virus subgenotyping based on RT-qPCR assays. BMC Microbiol 14: 296, 2014. PubMed: 25420941

Sánchez G, et al. Molecular characterization of hepatitis a virus isolates from a transcontinental shellfish-borne outbreak. J Clin Microbiol 41(11): 4148-4155, 2002. PubMed: 12409389

Prado T, Gaspar AM, Miagostovich MP. Detection of enteric viruses in activated sludge by feasible concentration methods. Braz J Microbiol 45(1): 343-349, 2014. PubMed: 24948954

Hussain Z, et al. Virological course of hepatitis A virus as determined by real time RT-PCR: Correlation with biochemical, immunological and genotypic profiles. World J Gastroenterol 12(29): 4683-4688, 2006. PubMed: 16937439

Mbayed VR, et al. Genetic characterization of hepatitis A virus isolates from Buenos Aires, Argentina. J Med Virol 68(2): 168-174, 2002. PubMed: 12210404

Rezende G, et al. Viral and clinical factors associated with the fulminant course of hepatitis A infection. Hepatology 38(3): 613-618, 2003. PubMed: 12939587

Costa-Mattioli M, et al. Quantification and duration of viraemia during hepatitis A infection as determined by real-time RT-PCR. J Viral Hepat 9(2): 101-106, 2002. PubMed: 11876791

Cross References

Nucleotide (GenBank) : K02990.1 Human hepatitis A virus, complete genome

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation