Quantitative Synthetic Plasmodium malariae DNA (ATCC® PRA-3001SD)

Depositor: ATCC  /  Biosafety Level: 1

Permits and Restrictions

View Permits

Application ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day-to-day test variation and lot-to-lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine protozoan load.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial in Biomatrica DNAstable
Storage Conditions -20°C or colder
Intended Use This product is intended for research use only. It is not intended for any animal or human therapeutic or diagnostic use. The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.

Biomatrica Logo
Comments Manufactured under ISO 13485 guidance

Preparation includes the 18S rRNA gene, untranslated region (UTR), cyclooxygenase 1 and 3 (Cox1 & Cox3), and Cytochrome B (Cytb)

The following primers and probe can be used with this nucleic acid preparation RefRougemont M, et al. Detection of four Plasmodium species in blood from humans by 18S rRNA gene subunit-based and species-specific real-time PCR assays. J Clin Microbiol 42(12): 5636-5643, 2004. PubMed: 15583293:
Forward primer: GTTAAGGGAGTGAAGACGATCAGA
Reverse primer: AACCCAAAGACTTTGATTTCTCATAA
Probe: ACCGTCGTAATCTTAACCATAAACTATGCCGACTAG
Name of Depositor ATCC
Special Collection DNA
References

Steenkeste N, et al. Towards high-throughput molecular detection of Plasmodium: new approaches and molecular markers. Malar J 8: 86, 2009. PubMed: 19402894

Boonma P, et al. Comparison of three molecular methods for the detection and speciation of Plasmodium vivax and Plasmodium falciparum. Malar J 6: 124, 2007. PubMed: 17868467

Rougemont M, et al. Detection of four Plasmodium species in blood from humans by 18S rRNA gene subunit-based and species-specific real-time PCR assays. J Clin Microbiol 42(12): 5636-5643, 2004. PubMed: 15583293

Kawamoto F, et al. Unusual Plasmodium malariae-like parasites in southeast Asia. J Parasitol 88(2): 350-357, 2002. PubMed: 12054010

Hayakawa T, et al. Identification of Plasmodium malariae, a human malaria parasite, in imported chimpanzees. PLoS One 4(10): e7412, 2009. PubMed: 19823579

Cross References

Nucleotide (GenBank) : AF488000 Plasmodium cf. malariae type 2 small subunit ribosomal RNA gene, complete sequence

Nucleotide (GenBank) : AB489193 Plasmodium malariae mitochondrial cox3, cox1, cytb genes for cytochrome oxidase subunit 3, cytochrome oxidase subunit 1, cytochrome b, partial cds, isolate: Oumu

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation