Cryptococcus neoformans (Sanfelice) Vuillemin, anamorph (ATCC® MYA-565)

Alternate State: Filobasidiella neoformans Kwon-Chung, teleomorph  /  Strain Designations: JEC21  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations JEC21
Alternate State Filobasidiella neoformans Kwon-Chung, teleomorph
Application
sensitive to cyclosporin A S-7481/F-1
sensitive to rapamycin
sensitive to tacrolimus FK-506, FK506
Emerging infectious disease research
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Antigenic Properties Serotype D
Genome Sequenced Strain

Yes

Mating Type alpha
Comments
Genome sequencing strain (completed by the Stanford Genome Technology Center (SGTC) and the Institute for Genomic Research (TIGR), USA).
Multigene phylogeny and phenotypic characterization.
Morphology After 3-5 days on YEPD at 30°C colonies are white to cream colored, smooth and have entire margins. Cells are mostly globose or ovoid, occurring singly or with buds.
Medium ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 28°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC

Morphology After 3-5 days on YEPD at 30°C colonies are white to cream colored, smooth and have entire margins. Cells are mostly globose or ovoid, occurring singly or with buds.
Name of Depositor J Heitman
Special Collection NCRR Contract
Cross References

Nucleotide (GenBank) : AE017341 Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete sequence.

References

Cruz MC, et al. Rapamycin antifungal action is mediated via conserved complexes with FKBP12 and TOR kinase homologs in Cryptococcus neoformans. Mol. Cell. Biol. 19: 4101-4112, 1999. PubMed: 10330150

Odom A, et al. Calcineurin is required for virulence of Cryptococcus neoformans. EMBO J. 16: 2576-2589, 1997. PubMed: 9184205

Arndt C, et al. Secretion of FK506/FK520 and rapamycin by Streptomyces inhibits the growth of competing Saccharomyces cerevisiae and Cryptococcus neoformans. Microbiology 145: 1989-2000, 1999. PubMed: 10463165

Loftus B, et al. The genome of the basidiomycetous yeast and human pathogen Cryptococcus neoformans. Science 307: 1321-1324, 2005.

Findley K, et al. Phylogeny and phenotypic characterization of pathogenic Cryptococcus species and closely related saprobic taxa in the Tremellales. Eukaryot. Cell 8: 353-361, 2009.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Restrictions Note: This material is available under the condition that it will not be used for commercial purposes or distributed to third parties.