Cryptococcus gattii (Vanbreus. et Takashio) Kwon-Chung et Boekhout, anamorph (ATCC® MYA-4877™)

Alternate State: Filobasidiella bacillispora Kwon-Chung, teleomorph  /  Strain Designations: A6MR38 [CBS 11545]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations A6MR38 [CBS 11545]
Alternate State Filobasidiella bacillispora Kwon-Chung, teleomorph
Biosafety Level 2
Product Format frozen
Type Strain no
Genotype VGIIc; AFLP6C
Mating Type MATalpha
Comments
highly virulent novel genotype RefByrnes EJ III, et al. Emergence and pathogenicity of highly virulent Cryptococcus gattii genotypes in the Northwest United States. PLoS Pathog. 6: e1000850, 2010. PubMed: 20421942
Morphology On YM medium at 25°C after 6 days, colonies creamy white to pale yellow, mucoid. Cells globose to subglobose, smooth, contain oil droplets, 3-5.25 µm X 3-5.25 µm. Pseudohyphae not observed.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATACTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCAGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 28S ribosomal RNA gene:

ACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGACCCGTCTT
Morphology On YM medium at 25°C after 6 days, colonies creamy white to pale yellow, mucoid. Cells globose to subglobose, smooth, contain oil droplets, 3-5.25 µm X 3-5.25 µm. Pseudohyphae not observed.
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- K Bartlett, E Burne, F Hagen
Isolation
CSF of immunicompetent human, Oregon, USA
Cross References

Nucleotide (GenBank) : JQ812708 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ812702 D1/D2 region of LSU rRNA gene

References

MacDougall, L., et al. Spread of Cryptoccus gattii in British Columbia, Canada, and detection in the Pacific Northwest, USA. Emerg. Infect. Dis. 13(1): 42-50, 2007. PubMed: 17370514

Byrnes EJ III, et al. Emergence and pathogenicity of highly virulent Cryptococcus gattii genotypes in the Northwest United States. PLoS Pathog. 6: e1000850, 2010. PubMed: 20421942

Byrnes EJ III, et al. Molecular evidence that the Vancouver Island Cryptococcus gattii outbreak has expanded into the United States Pacific Northwest. J. Infect. Dis. 199: 1081-1086, 2009. PubMed: 19220140

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS
Other Documentation
Other Document
Microbial Characterization Data