Geomyces destructans Blehert et Gargas (ATCC® MYA-4855)

Strain Designations: 20631-21  /  Product Format: frozen

Strain Designations 20631-21
Application
Emerging infectious disease research
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain yes
Genome Sequenced Strain

Yes

Comments
Psychrophilic fungus.
Pathogen causing bat white-nose syndrome.
Genome sequencing strain (The Broad Institute, USA).
Individuals that have contact with G. destructans should observe a personal quarantine and not enter bat congregation sites during active work and for 7 days after last contact with the fungus. Lab processes should be managed to avoid inadvertent contact with culture materials. Clothing and other materials brought into the laboratory should be segregated from those transported to any potential bat congregation sites.
Morphology On SDA at 10°C after 38 days, colonies white to grayish white, raised, dense velvety texture, slow growing, colony diameter after 38 days 1.8-2.3 cm. Production of light to dark brown exudate. Reverse buff to tan. Hyphae guttulate, 2.25 µm thick. Conidiophores with whorls of 2-6 verticils. Conidia formed singly and in short chains of 2-5, smooth, amygdaliform to allantoids with apical scar, containing oil droplets, 6-10.5 µm X 3-4.5 µm.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 4°C to 10°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GAAACCGTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTAGTCGCCCGGGTTGCCGCAAGGCCTCCCGGGTAACCTACCACCCTTTGTTTATTACACTTTGTTGCTTTGGCAGGCCTGCCCTCGGGCTGCTGGCTCCGGCCGGCGAGCGCTTGCCAGAGGACTAAACTCTGTTTGTCTATACTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACAACCCTCAAGCTCAGCTTGGTATTGGGCCCCGCCGACCCGGCGGGCCCTAAAGTCAGTGGCGGTGCCGTCCGGCTCCGAGCGTAGTAATTCTTCTCGCTCCGGAGGTCCGGTCGTGTGCTTGCCAGCAACCCCCAATTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene:

AACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCTCACGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGAGCATGGTCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCAGGTGCCTACGCTCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGCCGATCATCCGGTGTTCTCACCGGTGCACTCGGCCGTGCTCAGGCCAGCATCGGTTTTGGCGGCTGGATAAAGGCCCTAGGAATGTAGCTCCTCTCGGGGAGTGTTATAGTCTAGGGTGCAATGCAGCCTGCTGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTG

Morphology On SDA at 10°C after 38 days, colonies white to grayish white, raised, dense velvety texture, slow growing, colony diameter after 38 days 1.8-2.3 cm. Production of light to dark brown exudate. Reverse buff to tan. Hyphae guttulate, 2.25 µm thick. Conidiophores with whorls of 2-6 verticils. Conidia formed singly and in short chains of 2-5, smooth, amygdaliform to allantoids with apical scar, containing oil droplets, 6-10.5 µm X 3-4.5 µm.
Name of Depositor DS Blehert
Special Collection ATCC
Chain of Custody
ATCC <-- DS Blehert
Isolation
Wing skin of Myotis lucifugus, little brown bat, in Williams Hotel Mine, Ulster County, New York, USA, February 2008.
Cross References

Nucleotide (GenBank) : EU884921 Geomyces destructans isolate 20631-21 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence.

Nucleotide (GenBank) : FJ231098 Geomyces destructans isolate 20631-21 18S small subunit ribosomal RNA gene, partial sequence.

Complete Genome (GenBank) : AEFC00000000 Geomyces destructans 20631-21, whole genome shotgun sequencing project

References

Gargas A, et al. Geomyces destructans sp. nov. associated with bat white-nose syndrome. Mycotaxon 108: 147-154, 2009.

Lorch JM, et al. Experimental infection of bats with Geomyces destructans causes white-nose syndrome. Nature 480: 376-378, 2011. PubMed: 22031324

Blehert DS, et al. Bat white-nose syndrome: an emerging fungal pathogen? Science 323(5911): 227, 2009. PubMed: 18974316

Chaturvedi V, et al. Morphological and molecular characterizations of psychrophilic fungus Geomyces destructans from New York bats with White Nose Syndrome (WNS). PLoS ONE 5(5): e10783. PubMed: 20520731