Phanerochaete chrysosporium Burdsall, teleomorph (ATCC® MYA-4764)

Alternate State: Sporotrichum pulverulentum Novobranova, anamorph, Sporotrichum pruinosum Gilman et Abbott, anamorph  /  Strain Designations: RP-78 [FGSC 9002]  /  Product Format: frozen

Strain Designations RP-78 [FGSC 9002]
Alternate State Sporotrichum pulverulentum Novobranova, anamorph, Sporotrichum pruinosum Gilman et Abbott, anamorph
Application
degrades lignin
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
White rot fungus
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On potato dextrose medium at 25°C after 5 days, colonies white, mycelium appressed to agar surface, felt like texture becoming loosely cottony with age. Chlamydospores abundant, spherical to oblong, terminal, 28.5-39 µm X 25.5-34.5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAGGTGAACCTGCGGAAGGATCATTAACGAGTAACTGAACAGGTTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCTTCAGTTTAAGAATGTCTACCTGCGTACAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTGTTATCGAAGGCTTGGACTTGGAGGTTGTGCTGGCTTCTAGTCGAGTCGGCTCCTCTTAAATGTATTAGCGTGAGTGTAACGGATCGCTTCGGTGTGATAATTATCTGCGCCGTGGTCGTGAAGTAACATAAGCTTGCGCTTCTAACCGTCCTTCAGTTGGACAACTTACTTTGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCAT


D1D2 region of the 28S ribosomal RNA gene.

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTGGTTTCGGCCTGGTGCACTTCCTAGTAAACGGGCCAGCATCACTTTTGGCTGCGGGAAAAAGGTTAGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTAGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTTCTGGCGGGGCTTCGGCCACCTTCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTG

Morphology On potato dextrose medium at 25°C after 5 days, colonies white, mycelium appressed to agar surface, felt like texture becoming loosely cottony with age. Chlamydospores abundant, spherical to oblong, terminal, 28.5-39 µm X 25.5-34.5 µm.
Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Isolation
Homokaryotic strain derived from BKM-F-1767 (ATCC® 24725™)
Cross References

Nucleotide (GenBank) : JN874484 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JN882305 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AADS00000000 Phanerochaete chrysosporium RP-78, whole genome shotgun sequencing project

References

Stewart P, Gaskell J, Cullen D. A homokaryotic derivative of a Phanerochaete chrysosporium strain and its use in genomic analysis of repetitive elements. Appl Environ Microbiol. 66: 1629-1633, 2000.

Martinez D, et al. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat. Biotechnol. 22: 695-700, 2004.

Fernandez-Fueyo E, et al. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis. Proc. Natl. Acad. Sci. USA, in press (doi: 10.1073/pnas.1119912109).