Cryptococcus neoformans (Sanfelice) Vuillemin, anamorph (ATCC® MYA-4566)

Alternate State: Filobasidiella neoformans Kwon-Chung, teleomorph  /  Strain Designations: WM628 [CBS 10080]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations WM628 [CBS 10080]
Alternate State Filobasidiella neoformans Kwon-Chung, teleomorph
Application
Emerging infectious disease research
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Antigenic Properties Serotype AD
Genotype VNIII, AFLP3
Mating Type MATalpha
Comments
Reference strain of VN III, AFLP3 molecular type of C. neoformans.
Sequenced Data
D1D2 of LSU rDNA of MYA-4566

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC


ITS of MYA-4566

TTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAAT

Name of Depositor KJ Kwon-Chung
Special Collection ATCC
Chain of Custody
ATCC <-- KJ Kwon-Chung <-- W Meyer <-- S Chen
Isolation
Human, Australia.
Cross References

Nucleotide (GenBank) : FJ914904 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914893 ITS including 5.8S rRNA gene

References

Meyer W, et al. Molecular Typing of IberoAmerican Cryptococcus neoformans Isolates. Emerg. Infect. Dis. 9: 189-195, 2003.

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation