Candida albicans (Robin) Berkhout, anamorph (ATCC® MYA-427)

Strain Designations: A39 [DUMC 136.97]  /  Product Format: frozen

Strain Designations A39 [DUMC 136.97]
Application
negative control in differential gene expression studies
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
negative control in differential gene expression studies
Morphology Colonies after 3 days cream-colored, dull, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, hyaline, 2-7 x 3-8.5 µm, single or budding, occasionally forming short chains.

  

Medium ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTG

Morphology Colonies after 3 days cream-colored, dull, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, hyaline, 2-7 x 3-8.5 µm, single or budding, occasionally forming short chains.

  

Name of Depositor JR Perfect
Special Collection NCRR Contract
Isolation
human blood, Belgium
References

del Poeta M, et al. Cryptococcus neoformans differential gene expression detected in vitro and in vivo with green fluorescent protein. Infect. Immun. 67: 1812-1820, 1999. PubMed: 10085022

John R Perfect, personal communication