Candida albicans (Robin) Berkhout, anamorph (ATCC® MYA-1023)

Strain Designations: GT 157  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations GT 157
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Morphology After 3 days, colonies cream-colored, smooth, dull, dome-shaped.  Cells globose to short-ovoid, 2.0-7.0 x 3.0-8.5 µm, single or budding, occasionally forming short chains.

  

Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATGCTGCCAGCCTAGACCGAGGACTGCGGTTTTTAACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTG

Morphology After 3 days, colonies cream-colored, smooth, dull, dome-shaped.  Cells globose to short-ovoid, 2.0-7.0 x 3.0-8.5 µm, single or budding, occasionally forming short chains.

  

Name of Depositor ET Burt
Special Collection NCRR Contract
Chain of Custody
ATCC <-- ET Burt <-- B. Larsen
Isolation
clinical isolate, West Virginia, USA
References

Burt ET, et al. Isolation and identification of a 92-kDa stress induced protein from Candida albicans. Mycopathologia 147: 13-20, 1999.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation