Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 9763)

Alternate State: Candida robusta Diddens et Lodder  /  Product Format: freeze-dried

Deposited As Saccharomyces cerevisiae Hansen, teleomorph
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Alternate State Candida robusta Diddens et Lodder
Application
Assay of amphotericin
Assay of amphotericin B fungizone
Assay of anisomycin
Assay of antifongine
Assay of candicidin
Assay of natamycin pimaricin, tennecetin
Assay of nystatin fungicidin
Media testing
Produces arginase
Produces ethyl alcohol ethanol
Food testing
Pharmaceutical and Personal Care
Produces histone deacetylase
Produces nicotinic acid niacin
Sterility testing
Susceptibility testing
Testing disinfectants
Testing fungicides
Produces ethanol from saccharified whole corn mash
Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Comments
Invertase activity
Oligosaccharide transfer in microsomes
Deoxy-trehalose synthesis
Morphology On YM agar after 3 days at 25°C, colonies are cream colored, smooth, usually flat, occasionally raised in the centerpart. Older colonies may be slightly tan and opaque. Cells are ovoid, globose, budding, usually isolated or clustered, 3.0-8.0 by 5.0-10.0 µm.
Sequenced Data
The ITS region of the nuclear ribosomal RNA gene cluster was sequenced from a recently produced lot. Its sequence is as follows and matched 100% to GenBank accession GQ996543.
TTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTATAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAA
Morphology On YM agar after 3 days at 25°C, colonies are cream colored, smooth, usually flat, occasionally raised in the centerpart. Older colonies may be slightly tan and opaque. Cells are ovoid, globose, budding, usually isolated or clustered, 3.0-8.0 by 5.0-10.0 µm.
Name of Depositor NRRL
Isolation
Distillery yeast
Cross References

Nucleotide (GenBank) : GQ996543 ITS including 5.8S rRNA gene

References

Tseng MM, Phillips CR. The kinetics of yeast growth and nicotinic acid production. Biotechnol. Bioeng. 24: 1319-1325, 1982.

Hagemann G, et al. Fungicidal compound and process of making same. US Patent 3,052,605 dated Sep 4 1962

British Pharmacopoeia Commission Biological assay of antibiotics. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XIV A, 2003

Ness F, et al. Identification of yeast strains using the polymerase chain reaction. J. Sci. Food Agric. 62: 89-94, 1993.

Tran-Dinh S, et al. A novel approach for investigating reaction mechanisms in cells. Mechanism of deoxy-trehalose synthesis in Saccharomyces cerevisiae studied by 1H-NMR spectroscopy. Eur. J. Biochem. 228: 727-731, 1995. PubMed: 7737170

Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J. Clin. Microbiol. 32: 1625-1628, 1994. PubMed: 7929747

Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J. Clin. Microbiol. 32: 1650-1653, 1994. PubMed: 7929752

Chu FK, Maley F. Growth phase dependence of invertase mRNA levels in yeast. J. Biol. Chem. 255: 6387-6391, 1980. PubMed: 6993470

Trimble RB, et al. Effect of glucosylation of lipid intermediates on oligosaccharide transfer in solubilized microsomes from Saccharomyces cerevisiae. J. Biol. Chem. 255: 11892-11895, 1980. PubMed: 7002929

Sanchez del Pino MM, et al. Properties of the yeast nuclear histone deacetylase. Biochem. J. 303: 723-729, 1994. PubMed: 7980438

AOAC International Testing disinfectants against Staphylococcus aureus, hard surface carrier test method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 991.48.

European Pharmacopoeia Commission Microbiological assay of antibiotics. Strasbourg, France:European Pharmacopoeia Commission;European Pharmacopoeia EP 2.7.2, 1997

U.S. Pharmacopeia General Chapters; <81> Antibiotics-Microbial Assays. Rockville, MD: U.S. Pharmacopeia; USP USP34-NF29, 2011

AOAC International Antibiotics in feeds, microbiological methods. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 957.23.

Vazquez-Torres A, et al. Peroxynitrute contributes to the candidacidal activity of nitric oxide-producing macrophages. Infect. Immun. 64: 3127-3133, 1996. PubMed: 8757843

Bowman FW. Test organisms for antibiotic microbial assays. Antibiot. Chemother. 7: 639-640, 1957.

Platt TB, Itkin AG. Microbiological assay of nystatin in feeds. J. Assoc. Off. Anal. Chem. 57: 536-540, 1974. PubMed: 4833389

Chan PY, Cossins EA. Arginine metabolism in Saccharomyces cerevisiae. Some general properties of yeast arginase. Plant Cell Physiol. 14: 641-651, 1973.

Ziffer J, Iosif MI. Temperature effects in ethanol fermentation high corn media. Biotechnol. Lett. 4: 809-814, 1982.

Bowman FW, et al. Collaborative study of aerobic media for sterility testing by membrane filtration. J. Pharm. Sci. 60: 1087-1088, 1971. PubMed: 5000479

Microbial assay for antibiotics. Tokyo, Japan:Japanese Pharmacopoeia;JP JP14e.part I.34.

Microbiology of food and animal feeding stuffs--Guidelines on preparation and production of culture media-- Part 2: Practical guidelines on performance testing of culture media.. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 11133-2:2003.

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Chemical disinfectants and antiseptics -- Quantitative suspension test for the evaluation of fungicidal activity of chemical disinfectants and antiseptics used in food, industrial, domestic and institutional areas -- Test method and requirements (phase 2, step 1). London, UK:British Standards Institution;British Standard BS EN 1650:1998.

Chemical disinfectants and antiseptics - Preservation of test organisms used for the determination of bactericidal, sporicidal and fungicidal activity. London, UK:British Standards Institution;British Standard BS EN 12353:2006.

Chemical disinfectants and antiseptics --- Quantitative non-porous surface test for the evaluation of bactericidal and/or fungicidal activity of chemical disinfectants used in food, industrial, domestic and institutional areas --- Test method and requirements without mechanical action (phase 2/step 2). London, UK:British Standards Institution;British Standard BS EN 13697:2001.

Chemical disinfectants and antiseptics --- Application of European Standards for chemical disinfectants and antiseptics. London, UK:British Standards Institution;British Standard BS EN 14885:2006.

Microbiology of food and animal feeding stuffs --- Guidelines on preparation and production of culture media --- Part 2: Practical guidelines on performance testing of culture media - Annex B: Recommended test microorganisms for commonly used culture media. London, UK:British Standards Institution;British Standard DD CEN ISO/TS 11133:2003.

ISO/CD 11133:2009, Annex E. Test microorganisms for commonly used culture media (giving information on the culture medium, culture conditions, test microorganisms, culture collection number of test organisms and the expected reactions)

Corry, JEL, Curtis, GDW and Baird, RM (Eds) Handbook of Culture Media for Food and Water Microbiology. Royal Society of Chemistry, In preparation. ICFMH-WPCM.