Candida albicans (Robin) Berkhout, anamorph (ATCC® 96901)

Strain Designations: 321182  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations 321182
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Comments
Fluconazole-resistant, patient 2
Morphology After 3 days at 30°C, colonies cream-colored, smooth, dull, dome-shaped, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, thin-walled, hyaline.

 

Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGAA

Morphology After 3 days at 30°C, colonies cream-colored, smooth, dull, dome-shaped, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, thin-walled, hyaline.

 

Name of Depositor MG Rinaldi
Special Collection NCRR Contract
Chain of Custody
ATCC <-- MG Rinaldi <-- S Swindells
Isolation
mouth of HIV-positive patient, Omaha, NE
References

Boken DJ, et al. Fluconazole-resistant Candida albicans. Clin. Infect. Dis. 17: 1018-1021, 1993. PubMed: 8110924

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation