Rhodotorula mucilaginosa (Jorgensen) Harrison var. mucilaginosa, anamorph (ATCC® 9449)

Strain Designations: NRRL Y-1592 [CBS 17, CCRC 21667, IGC 4791, MUCL 30397, VKM Y-341]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Rhodotorula rubra (Demme) Lodder, anamorph
Strain Designations NRRL Y-1592 [CBS 17, CCRC 21667, IGC 4791, MUCL 30397, VKM Y-341]
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Rhodotorula rubra (Demme) Lodder)
Preceptrol® no
Comments
Available as Uniplus (Ref TM) ATCC 9449-U
Morphology

After 3 days at 25°C the cells are ovoidal to spherical  and may occur singly, in pairs, in short chains or small clusters.  There may be a light strawberry-pink ring and light to moderate sediment. 

Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATATAGGACGTCCAACTTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCACTTGTTTGGGATAGTAACTCTCGCAAGAGAGCGAACTCCTATTCACTTATAAACACAAAGTCTATGAATGTATTAAATTTTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATACTTCAACCCTCCTCTTTCTTAATGATTGAAGAGGTGTTTGGTTTCTGAGCGCTGCTGGCCTTTACGGTCTAGCTCGTTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGAATTCTAGTCTTCGGATTAGAGCCGGGTTGGGTTAAAGGAAGCTTCTAATCAGAATGTCTACATTTTAAGATTAGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGAC

Morphology

After 3 days at 25°C the cells are ovoidal to spherical  and may occur singly, in pairs, in short chains or small clusters.  There may be a light strawberry-pink ring and light to moderate sediment. 

Name of Depositor NRRL
Chain of Custody
ATCC <-- RRL <-- CBS 17 <-- G. Pollacci
Cross References

Nucleotide (GenBank) : AF189960 26S ribosomal RNA gene, partial sequence

References

Lodder J, Kreger-van Rij MJW. The yeasts: a taxonomic study. 1st ed.Amsterdam: North-Holland; 1952.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

type strain of Rhodotorula rubra (Demme) Lodder

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation