Penicillium brevi-compactum Dierckx, anamorph (ATCC® 9056)

Strain Designations: NRRL 864 [42, 4733.21, ATCC 10418, CBS 257.29, DSM 3825, Dierckx, IMI 40225, MUCL 30241, NRRL 2011, QM 7496]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL 864 [42, 4733.21, ATCC 10418, CBS 257.29, DSM 3825, Dierckx, IMI 40225, MUCL 30241, NRRL 2011, QM 7496]
Application
produces asperphenamate
produces brevianamide A
produces brevianamide B
produces ergosterol
produces hydroxygrindelanes
produces mycophenolic acid
produces insecticide hydroxygrindelanes
Biosafety Level 1
Product Format freeze-dried
Type Strain yes (type strain)
Preceptrol® no
Comments
Transformations of antitumor agents
life cycle
Morphology

Colonies on malt agar growing moderately rapidly, granular, olivaceous-green, reverse yellowish to reddish-brown. Conidiophore stipes smooth-walled; penicillia generally terverticillate. Phialides flask-shaped. Conidia smooth-walled or slightly verruculose, ellipsoidal, 2.5-3.5 µm.

Medium Medium 312: Czapek's agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data
      18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGAGCCTGCCTTTTGGCTGCCGGGGGACGTCTGTCCCCGGGTCCGCGCTCGCCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGACTGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAA

Morphology

Colonies on malt agar growing moderately rapidly, granular, olivaceous-green, reverse yellowish to reddish-brown. Conidiophore stipes smooth-walled; penicillia generally terverticillate. Phialides flask-shaped. Conidia smooth-walled or slightly verruculose, ellipsoidal, 2.5-3.5 µm.

Name of Depositor NRRL
Chain of Custody
ATCC <<--NRRL<<--C. Thom 4733.21 <<--- P. Biourge 42, strain Dierckx
Cross References

Nucleotide (GenBank) : JQ070074 ITS including 5.8S rRNA gene

References

Bird BA, Campbell IM. Disposition of mycophenolic acid, brevianamide A, asperphenamate, and ergosterol in solid cultures of Penicillium brevicompactum. Appl. Environ. Microbiol. 43: 345-348, 1982.

Bartman CD. Mycophenolic acid production by Penicillium brevicompactum on solid media. Appl. Environ. Microbiol. 41: 729-736, 1981.

. The genus Penicillium. London: Academic Press; 1979.

Doerfler DL, et al. Spore germination, colony development, and secondary metabolism in Penicillium brevicompactum: a radiogas chromatographic and morphological study. Can. J. Microbiol. 24: 1490-1501, 1978. PubMed: 747811

Chien MM, Rosazza JP. Microbial transformations of natural antitumor agents. 9. O-Demethylation of 9-methoxyellipticine. J. Nat. Prod. 42: 643-647, 1979. PubMed: 575547

Bird BA, Campbell IM. Occurrence and biosynthesis of asperphenamate in solid cultures of Penicillium brevicompactum. Phytochemistry 21: 2405-2406, 1982.

Hoffmann JJ, et al. Hydroxygrindelane derivatives by microbial transformation. Phytochemistry 27: 2125-2127, 1988.

Bird BA, et al. Brevianamides A and B are formed only after conidiation has begun in solid cultures of Penicillium brevicom pactum. Appl. Environ. Microbiol. 42: 521-525, 1981.

Clutterbuck PW, Raistrick H. Studies in the biochemistry of microorganisms. The molecular constitution of the metabolic products of Penicillium brevi-compactum Dierckx and related species. II. Mycophenolic acid. Biochem. J. 27: 654-667, 1933.

type strain

type strain

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation