Naumovozyma castellii (Capriotti) Kurtzman (ATCC® 76901)

Strain Designations: CBS 4309 [IFO 1992, NRRL Y-12630, VKPM Y-1485]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Saccharomyces castellii Capriotti, teleomorph
Strain Designations CBS 4309 [IFO 1992, NRRL Y-12630, VKPM Y-1485]
Biosafety Level 1
Product Format freeze-dried
Type Strain yes (type strain)
Genome Sequenced Strain

Yes

Comments
ITS-PCR ribotyping
Genome sequencing strain (Washington University School of Medicine, USA).
Mitochondrial genome sequencing completed.
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
    18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

ATTTGAGGTCAAACTTAAGAGTATTGTTCGCCAATGCGTCGGCTCGCTTTCCATTGGGTTTCGCAAAGAGTCGTAGTAACGCCCACTAACACTACGTCCGTCGAAGTTGGTAAAACCTAATACGACAATCGGTATCAGCAGACTGGACAAATCGCTCCGTCCAAAGTCAGCAATCAACAGCTATTATATGGCTAGCAATTTCAAGTTAACTCTAGAAAGAGTGTCACTCACTACCAAAGAAGAGTTCTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAAATTATTTGTATTTCATAACGAAATTGGTTTTGACTTGATTATAATATAACAAAATTGTTTGTGTTTGTCAACTCCGGGCTCTTGCAAGCCCAAAGAAGAAGAAGTGTTTTAAAAGAAAACTCCAGTGTGTGTATAATTTTTAGGCAGTGAACCGCAGACAGAGAAACAGTGAATACAGAAGCCCCGGCGGAGAACCGCGCAATTAAGCGCAGGCAGTCTCCTCCAGCACTCCCCACCGAATCCCCCTACGATCGACCCAAT

Name of Depositor CBS
Chain of Custody
ATCC <<--CBS<<--A. Capriotti
Isolation
soil, Finland
Cross References

Complete Genome (GenBank) : AACF00000000 Naumovozyma castellii NRRL Y-12630, whole genome shotgun sequencing project

References

Capriotti A. Saccharomyces castellii n. sp. Una nuova specie di lievito isolata da un terreno della Finlandia. Ann. Fac. Agrar. Univ. Sassari, Stud. Sassaresi III 14: 453-458, 1966.

McCullough MJ, et al. Intergenic transcribed spacer PCR ribotyping for differentiation of Saccharomyces species and interspecific hybrids. J. Clin. Microbiol. 36: 1035-1038, 1998. PubMed: 9542932

type strain

Kurtzman CP. Phylogenetic circumscription of Saccharomyces, Kluyveromyces and other members of the Saccharomycetaceae, and the proposal of the new genera Lachancea, Nakaseomyces, Naumovia, Vanderwaltozyma and Zygotorulaspora. FEMS Yeast Res. 4: 233-245, 2003.

Cliften P, et al. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 30: 71-76, 2003. PubMed: 2775844

Petersen RF, et al. Inheritance and organisation of the mitochondrial genome differ between two Saccharomyces yeasts. J. Mol. Biol. 318: 627-636, 2002. PubMed: 12054811

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Gordon JL, et al. Evolutionary erosion of yeast sex chromosomes by mating-type switching accidents. Proc. Natl. Acad. Sci. USA. 108: 20024-20029, 2011. PubMed: 22123960

type strain

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation