Lachancea kluyveri (Phaff et al.) Kurtzman (ATCC® 58438)

Strain Designations: CBS 3082 [CCRC 21498, DBVPG 6177, IFO 1685, JCM 7257, NCYC 543, NRRL Y-12651, UCD 51-242]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces kluyveri Phaff et al., teleomorph
Strain Designations CBS 3082 [CCRC 21498, DBVPG 6177, IFO 1685, JCM 7257, NCYC 543, NRRL Y-12651, UCD 51-242]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain yes (type strain)
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
alkali-tolerant at pH 10
Genome sequencing strain (Genolevures Consortium, France).
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data

       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GCGGAAGGATCATTAAAGATTTTTGATTGGAGCAGCCGGGGGAGTGCCAGCCAGCCTGCGCTTAATTGCGCGGCCGACGGTGCTTTCTGTTAACGGTTGTCTCTTTCTACACACACACTGTGGAGTTTTTTCTACTTTGCTACTTTTTCTTTGGGCGCAAGCCCAGAGGATACAAAACACAAACAATTTTTCATGTTTATTTTAGTCAAGAAATTTTCATTTTAAGAAAATAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACCTTTGGGTTTGGTCGTGAGTGATACTCTTTCCAGGGTTAACTTGAAAATGCTGGCCATCTGGCTGCTGCTGGCTGAGGCTCTAGTCCAGTCTGCTGATACTCGACGTATTAGGTTTTACCAACTCGTTGTGGCATCGGTCGGGCGTTATTACGACTCTAGCACGAAAGTACAGACAGCCTGGCGAATAGTATTCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATC

Name of Depositor CBS
Chain of Custody
ATCC <<--CBS<<--H.J. Phaff UCD 51-242
Isolation
fruit fly, Drosophila pinicola, California
Cross References

Complete Genome (GenBank) : AACE00000000 Lachancea kluyveri NRRL Y-12651, whole genome shotgun sequencing project

References

Phaff HJ, et al. The taxonomy of yeasts isolated from Drosophila in the Yosemite region of California. Antonie van Leeuwenhoek 22: 145-161, 1956.

Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.

type strain

Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.

Neuvéglise C, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 9. Saccharomyces kluyveri. FEBS Lett. 487: 56-60, 2000.

Cliften P, et al. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 30: 71-76, 2003. PubMed: 2775844

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

type strain

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation