Lachancea kluyveri (Phaff, M.W. Miller et Shiffrine) Kurtzman, teleomorph (ATCC® 58438)

Strain Designations: CBS 3082 [CCRC 21498, DBVPG 6177, IFO 1685, JCM 7257, NCYC 543, NRRL Y-12651, UCD 51-242]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Saccharomyces kluyveri Phaff et al., teleomorph
Strain Designations CBS 3082 [CCRC 21498, DBVPG 6177, IFO 1685, JCM 7257, NCYC 543, NRRL Y-12651, UCD 51-242]
Biosafety Level 1
Product Format freeze-dried
Type Strain yes (type strain)
Genome Sequenced Strain

Yes

Comments
alkali-tolerant at pH 10
Genome sequencing strain (Genolevures Consortium, France).
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data

       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GCGGAAGGATCATTAAAGATTTTTGATTGGAGCAGCCGGGGGAGTGCCAGCCAGCCTGCGCTTAATTGCGCGGCCGACGGTGCTTTCTGTTAACGGTTGTCTCTTTCTACACACACACTGTGGAGTTTTTTCTACTTTGCTACTTTTTCTTTGGGCGCAAGCCCAGAGGATACAAAACACAAACAATTTTTCATGTTTATTTTAGTCAAGAAATTTTCATTTTAAGAAAATAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACCTTTGGGTTTGGTCGTGAGTGATACTCTTTCCAGGGTTAACTTGAAAATGCTGGCCATCTGGCTGCTGCTGGCTGAGGCTCTAGTCCAGTCTGCTGATACTCGACGTATTAGGTTTTACCAACTCGTTGTGGCATCGGTCGGGCGTTATTACGACTCTAGCACGAAAGTACAGACAGCCTGGCGAATAGTATTCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATC

Name of Depositor CBS
Chain of Custody
ATCC <<--CBS<<--H.J. Phaff UCD 51-242
Isolation
fruit fly, Drosophila pinicola, California
Cross References

Complete Genome (GenBank) : AACE00000000 Lachancea kluyveri NRRL Y-12651, whole genome shotgun sequencing project

References

Phaff HJ, et al. The taxonomy of yeasts isolated from Drosophila in the Yosemite region of California. Antonie van Leeuwenhoek 22: 145-161, 1956.

Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.

type strain

Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.

Neuvéglise C, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 9. Saccharomyces kluyveri. FEBS Lett. 487: 56-60, 2000.

Cliften P, et al. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 30: 71-76, 2003. PubMed: 2775844

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

type strain

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation