Aspergillus oryzae (Ahlburg) Cohn, anamorph (ATCC® 42149)

Strain Designations: RIB40  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Aspergillus oryzae var. viridis Murakami, anamorph
Strain Designations RIB40
Application
produces acetamidase
produces acid protease protease (acid)
produces glucoamylase
produces taka-amylase A
Cloning of the taka-amylase A gene
Cloning of the acetamidase gene
Cloning of the acid protease-encoding gene DDBJ D13894
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (National Institute of Technology and Evaluation (NITE), Japan).
Morphology

After 10 days at 25°C colonies growing rapidly, floccose with relatively small conidial structures that originate within the loose aerial mycelium.  Vesicles are small and somewhat elongate; conidia are essentially globose, smooth or nearly so and mostly 4.5 to 5.5 µm in. diameter.

Medium ATCC® Medium 312: Czapek's agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CACTCTACTTGTGCGCTATCGGTCTCCGGCCAGTATTTAGCTTTAGATGAAATTTACCACCCATTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGGGCGCGGACACCCATCCCAGACGGGATTCTCACCCTCTCTGACGGCCCGTTCCAGGGCACTTAGACAGGGGCCGCACCCGAAGCATCCTCTGCAAATTACAATGCGGACCCCGAAGGAGCCAGCTTTCAAATTTGAGTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAAAGATTGATTTGGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTCGGAAACCTTGTTACGA

Morphology

After 10 days at 25°C colonies growing rapidly, floccose with relatively small conidial structures that originate within the loose aerial mycelium.  Vesicles are small and somewhat elongate; conidia are essentially globose, smooth or nearly so and mostly 4.5 to 5.5 µm in. diameter.

Name of Depositor K Nojiro
Chain of Custody
ATCC <<--K Nojiro<<--H. Murakami
Isolation
cereal
Cross References

Nucleotide (GenBank) : D63941 Aspergillus oryzae enoA gene for enolase, complete cds. enolase (= phophopyruvate hydratase) gene, enoA

Nucleotide (GenBank) : E03046 DNA sequence coding for glyceraldehyde-3-phosphate dehydrogenase derived from Aspergillus oryzae.

References

Gomi K, et al. Cloning and nucleotide sequence of the acid protease-encoding gene (pepA) from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 57: 1095-1100, 1993. PubMed: 7763981

Gomi K, et al. Cloning and molecular characterization of the acetamidase-encoding gene (amdS) from Aspergillus oryzae. Gene 108: 91-98, 1991. PubMed: 1840550

Machida M, et al. Molecular cloning of a genomic DNA for enolase from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 60: 161-163, 1996. PubMed: 8824839

. . Agric. Biol. Chem. 53: 593-599, 1989.

. . Agric. Biol. Chem. 56: 207-210, 1992.

Razzaque A, Ueda S. Glucoamylase of Aspergillus oryzae. J. Ferment. Technol. 56: 296-302, 1978.

Machida M, et al. Genome sequencing and analysis of Aspergillus oryzae. Nature 438: 1157-1161, 2005.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Akao T, et al. Analysis of expressed sequence tags from the fungus Aspergillus oryzae cultured under different conditions. DNA Res. 14: 47-57, 2007. PubMed: 17540709

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation