Aspergillus nidulans (Eidam) Winter, anamorph (ATCC® 38163)

Alternate State: Emericella nidulans (Eidam) Vuillemin, teleomorph  /  Strain Designations: G00 [ATCC 12996, ATCC 26451, C. Thom 5616.1, CBS 112.46, FGSC A4, Glasgow wild-type, Pontecorvo strain, IMI 38576ii, NRRL 194, SRRC 273, WB 194, Yuill A69, biA-1]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations G00 [ATCC 12996, ATCC 26451, C. Thom 5616.1, CBS 112.46, FGSC A4, Glasgow wild-type, Pontecorvo strain, IMI 38576ii, NRRL 194, SRRC 273, WB 194, Yuill A69, biA-1]
Alternate State Emericella nidulans (Eidam) Vuillemin, teleomorph
Application
produces ferricrocin
produces triacetylfusigen
transformation host
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Genotype argB
Genome Sequenced Strain

Yes

Comments
Biotin-dependent as standard wild type for most purposes
Genome sequencing strain (Broad Institute, USA).
Medium ATCC® Medium 627: Aspergillus medium
Growth Conditions
Temperature: 37.0°C
Sequenced Data
   18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

   CCTGCGGAAGGATCATTACCGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCCCCCCAGGGGCGAGCCGCCGGGGACCACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGCCTGAATACAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGATTAGGGCCGGCCGGGCGCCAGCCGGCGTCTCCAACCTTATTTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Name of Depositor AJ Clutterbuck
Cross References

Complete Genome (GenBank) : AACD00000000 Aspergillus nidulans FGSC A4, whole genome shotgun sequencing project

References

Charlang G, et al. Cellular and extracellular siderophores of Aspergillus nidulans and Penicillium chrysogenum. Mol. Cell. Biol. 1: 94-100, 1981. PubMed: 6242827

Pontecorvo G, et al. The genetics of Aspergillus nidulans. Adv. Genet. 5: 142-238, 1953.

Zonneveld BJ. Inhibitory effect of 2-Deoxyglucose on cell wall alpha-1,3-glucan synthesis and cleistothecium development in Aspergillus nidulans. Dev. Biol. 34: 1-8, 1973. PubMed: 4595497

Dorn GL. A revised map of the eight linkage groups of Aspergillus nidulans. Genetics 56: 619-631, 1967. PubMed: 6061654

Lin WL, et al. Kinetics of cell growth and heterologous glucoamylase production in recombinant Aspergillus nidulans. Biotechnol. Bioeng. 41: 273-279, 1993.

Timberlake WE. Low repetitive DNA content in Aspergillus nidulans. Science 202: 973-975, 1978. PubMed: 362530

Yadwad VB, et al. Effect of culture conditions and induction strategies on production of human interleukin-6 by a recombinant Aspergillus nidulans strain. Mycol. Res. 100: 356-360, 1996.

Galagan JE, et al. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438: 1105-1115, 2005. PubMed: 16372000

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation