Fusarium solani (Martius) Saccardo, anamorph (ATCC® 36031)

Alternate State: Nectria haematococca Berkeley et Broome, teleomorph  /  Strain Designations: FIV/74  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations FIV/74
Alternate State Nectria haematococca Berkeley et Broome, teleomorph
Application
Testing
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Comments
Proteolytic activity
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TTCGAGGTCACATTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGCCGCTCTCCAGTTGCGAGGTGTTAGCTACTACGCAATGGAAGCTGCGGCGGGACCGCCACTGTATTTGGGGGACGGCGTGTGCCCGCAGGGGGCGCCTCGCCGATCCCCAACGCCAGGCCCGGGGGCCTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTGTTTTACTCAGAAGAAACATAATAGAAACAGAGTTAGGGGGTCCTCTGGCGGGGGCGGCCCGTGTTACGGGGCCGTCTGTTCCCGCCGAAGCAACGTTTTAGGTATGTTCACAGGGTTGATGAGTTGTATAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTTCCTCTAAATGACCGAGTTTGGAGAGCTTTCC

Name of Depositor HC Gugnani
Isolation
Corneal ulcer in man, Anambra State, Nigeria
References

Gugnani HC, et al. Mycotic keratitis in Nigeria. A study of 21 cases. Br. J. Ophthalmol. 60: 607-613, 1976. PubMed: 791355

Ophthalmic optics--Contact lens care products--Microbiological requirements and test methods for products and regimens for hygienic management of contact lenses. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 14729:2001.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation