Filobasidiella neoformans Kwon-Chung, teleomorph (ATCC® 28957)

Strain Designations: [CBS 6885, NRRL Y-17397]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations [CBS 6885, NRRL Y-17397]
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Type Strain yes (type strain, mating type alpha)
Antigenic Properties serotype D RefKwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816
Preceptrol® no
Mating Type mates with ATCC 28958 mating type alpha self-fertile mates with ATCC 28958 RefSchmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981. , RefKwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA

Name of Depositor KJ Kwon-Chung
Isolation
human bone lesion
References

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816

type strain, mating type alpha

type strain, mating type alpha

Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816

Schmeding KA, et al. Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138, 1981.

Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200, 1975. PubMed: 765816

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation