Penicillium rubens Biourge (ATCC® 28089)

Strain Designations: WIS 54-1255 [Wis. 51-20; Wis. 48-70; NRRL 1951; ATCC 9480]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium chrysogenum Thom, anamorph
Strain Designations WIS 54-1255 [Wis. 51-20; Wis. 48-70; NRRL 1951; ATCC 9480]
Application
produces acyl-CoA-6-aminopenicillanic acid acyltransferase
produces isopenicillin N synthetase
produces penicillin
produces penicillin V
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
High penicillin producer
Phenylacetic acid transport system
Genome sequencing strain (DSM Anti-Infectives, The Netherlands).
The strain was reclassified as Penicillium rubens based on a recent molecular phylogenetic study. RefHoubraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767
Morphology After 5-6 days at 25°C on potato dextrose medium colonies growing rapidly, velutinous to floccose. Conidiophore stipes smooth-walled, 200-300 µm long; penicilli usually terverticillate. Metulae 8-12 µm long. Phialides flask-shaped, 7-10 µm long. Conidia smooth-walled, ellipsoidal, 2.5-4.0 µm long, blue or bluish-green.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGTAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAACGAC

Morphology After 5-6 days at 25°C on potato dextrose medium colonies growing rapidly, velutinous to floccose. Conidiophore stipes smooth-walled, 200-300 µm long; penicilli usually terverticillate. Metulae 8-12 µm long. Phialides flask-shaped, 7-10 µm long. Conidia smooth-walled, ellipsoidal, 2.5-4.0 µm long, blue or bluish-green.
Name of Depositor CY O'Sullivan
Chain of Custody
ATCC <-- CY O'Sullivan <-- Wis. 51-20 <-- Wis. 48-70 <-- NRRL 1951
References

O'Sullivan CY, Pirt SJ. Penicillin production by lysine auxotrophs of Penicillium chrysogenum. J. Gen. Microbiol. 76: 65-75, 1973. PubMed: 4198715

Luengo JM, et al. Direct enzymatic synthesis of penicillin G using cyclases of Penicillium chrysogenum and Acremonium chrysogenum. Bio-Technology 4: 44-47, 1986.

Ramsay BA, et al. Penicillin production in an inverse fluidized bed bioreactor. J. Ferment. Bioeng. 72: 495-497, 1991.

Ferrero MA, et al. Biosynthesis of benzylpenicillin (G), phenoxymethylpenicillin (V) and octanoylpenicillin (K) from glutathione S-derivatives. J. Antibiot. 43: 684-691, 1990. PubMed: 2166024

Martin-Villacorta J, et al. Acyl-CoA: 6-APA acyltransferase from Penicillium chrysogenum studies on its hydrolytic activity. J. Antibiot. 44: 108-110, 1991. PubMed: 1848214

Ferrero MA, et al. In vitro enzymatic synthesis of new penicillins containing keto acids as side chains. Antimicrob. Agents Chemother. 35: 1931-1932, 1991. PubMed: 1952871

Alonso MJ, et al. Enzymatic synthesis of penicillins. J. Antibiot. 41: 1074-1084, 1988. PubMed: 3170343

Fernandez-Canon JM, et al. Uptake of phenylacetic acid by Penicillium chrysogenum Wis 54-1255: a critical regulatory point in benzylpenicillin biosynthesis. J. Antibiot. 42: 1398-1409, 1989. PubMed: 2507493

Fernandez-Canon JM, et al. Phenylacetic acid transport system in Penicillium chrysogenum Wis 54- 1255: molecular specificity of its induction. J. Antibiot. 42: 1410-1415, 1989. PubMed: 2507494

Martinez-Blanco H, et al. Repression of phenylacetic acid transport system in Penicillium chrysogenum Wis 54-1255 by free amino acids and ammonium salts. J. Antibiot. 42: 1416-1423, 1989. PubMed: 2507495

MacDonald KD, et al. Properties of heterozygous diploids between strains of Penicillium chrysogenum selected for high penicillin yield. Antonie van Leeuwenhoek 30: 209-224, 1964.

Xu Z, et al. Genome physical mapping from large-insert clones by fingerprint analysis with capillary electrophoresis: a robust physical map of Penicillium chrysogenum. Nucleic Acids Res. 33: e50, 2005. PubMed: 15767275

van den Berg MA, et al. Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 26:1161-1168, 2008. PubMed: 18820685

Houbraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation