Cryptococcus magnus (Lodder et Kreger-van Rij) Baptist et Kurtzman (ATCC® 20918)

Strain Designations: IFF-8275c  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Cryptococcus albidus (Saito) Skinner, anamorph
Strain Designations IFF-8275c
Application
produces lactones
produces sclareolide
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
ITS and D1D2 sequences of this strain 100% match those of many Cryptococcus magnus strains and some Filobasidium floriforme strains. Thus the name is updated.
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
    18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TAGATTGAACCATAGGCGAAAGCCAGTGGTTCTTCTTTCATATCCATAACACCTGTGCACTGTTGGATGCTTGCATCCACTTTTAAACTAAACATTATTGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAAACCCAAGTTTTGGATTTCGATCCATGCTTGAGTTTGGATTTGGATGTTTGCCGGTGATGAACCGACTCATCTTAAAAGTATTAGCTTGGATCTGTCTATATGACTGGTTTGACTTGGCATAATAAGTATTTTGCTGAGGACATCTTCGGATGGCCAGGACCTAGACTACTGTCTGCTAACTAAACCATCACTTTAAGTGCATCTTTGGATGTTACTCATTGTGTAACTTTGACATCTGGCCTCAAATCAAG

        Large subunit ribosomal RNA gene, partial sequence.

AGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGTGGCCTCAGGTCATCCGAGTTGTAATCTATAGAAGTGTTTTCCGTGCTGGCTCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGAACTACCAGTGCTCTGTGATACATTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGCTCTTTGGATTCAGCCGGTTCTGCCGGTGTACTTCCTTTGAGTGGGGTCAACATCAGTTTTGATCGCTGGATAAAGGCTGGAGGAACGTAGTACCCTCGGGTAAACTTATAGCCTCCTGTCACATACAGTGGTTGGGACTGAGGAACGCAGCACGCCTTTATGGCCGGGATTCGTCCACGTACGTGCTTAGGATGTTGAC

Name of Depositor International Flavors & Fragrances, Inc.
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished.
Isolation
soil, Mexico City, Mexico
Cross References

Nucleotide (GenBank) : JQ070166 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070097 ITS including 5.8S rRNA gene

References

Farbood MI, et al. Process for producing diol and lactone and microorganisms capable of same. US Patent 4,970,163 dated Nov 13 1990

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation