Cryptococcus magnus (Lodder et Kreger-van Rij) Baptist et Kurtzman (ATCC® 20918)

Strain Designations: IFF-8275c  /  Product Format: freeze-dried

Deposited As Cryptococcus albidus (Saito) Skinner, anamorph
Strain Designations IFF-8275c
Application
produces lactones
produces sclareolide
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
ITS and D1D2 sequences of this strain 100% match those of many Cryptococcus magnus strains and some Filobasidium floriforme strains. Thus the name is updated.
Medium Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
    18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TAGATTGAACCATAGGCGAAAGCCAGTGGTTCTTCTTTCATATCCATAACACCTGTGCACTGTTGGATGCTTGCATCCACTTTTAAACTAAACATTATTGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACCCTCAAACCCAAGTTTTGGATTTCGATCCATGCTTGAGTTTGGATTTGGATGTTTGCCGGTGATGAACCGACTCATCTTAAAAGTATTAGCTTGGATCTGTCTATATGACTGGTTTGACTTGGCATAATAAGTATTTTGCTGAGGACATCTTCGGATGGCCAGGACCTAGACTACTGTCTGCTAACTAAACCATCACTTTAAGTGCATCTTTGGATGTTACTCATTGTGTAACTTTGACATCTGGCCTCAAATCAAG

        Large subunit ribosomal RNA gene, partial sequence.

AGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGTGGCCTCAGGTCATCCGAGTTGTAATCTATAGAAGTGTTTTCCGTGCTGGCTCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGAACTACCAGTGCTCTGTGATACATTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGCTCTTTGGATTCAGCCGGTTCTGCCGGTGTACTTCCTTTGAGTGGGGTCAACATCAGTTTTGATCGCTGGATAAAGGCTGGAGGAACGTAGTACCCTCGGGTAAACTTATAGCCTCCTGTCACATACAGTGGTTGGGACTGAGGAACGCAGCACGCCTTTATGGCCGGGATTCGTCCACGTACGTGCTTAGGATGTTGAC

Name of Depositor International Flavors & Fragrances, Inc.
Isolation
soil, Mexico City, Mexico
Cross References

Nucleotide (GenBank) : JQ070166 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070097 ITS including 5.8S rRNA gene

References

Farbood MI, et al. Process for producing diol and lactone and microorganisms capable of same. US Patent 4,970,163 dated Nov 13 1990