Cryptococcus neoformans var. grubii (ATCC® 208821)

Strain Designations: H99 [H99JP, NYSD 1649]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cryptococcus neoformans (Sanfelice) Vuillemin, anamorph
Strain Designations H99 [H99JP, NYSD 1649]
Application
Biomedical Research and Development Material
Emerging infectious disease research
Negative control in differential gene expression studies Refdel Poeta M, et al. Cryptococcus neoformans differential gene expression detected in vitro and in vivo with green fluorescent protein. Infect. Immun. 67: 1812-1820, 1999. PubMed: 10085022
produces laccase RefWilliamson PR, et al. Melanin biosynthesis in Cryptococcus neoformans. J. Bacteriol. 180: 1570-1572, 1998. PubMed: 9515929
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (Type strain of Cryptococcus neoformans var. grubii)
Antigenic Properties Serotype A RefWilliamson PR, et al. Melanin biosynthesis in Cryptococcus neoformans. J. Bacteriol. 180: 1570-1572, 1998. PubMed: 9515929, RefFranzot SP, et al. Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840, 1999. PubMed: 9986871
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type Mating type: alpha (Peter R Williamson, personal communication)
Comments
Multigene phylogeny and phenotypic characterization. RefFindley K, et al. Phylogeny and phenotypic characterization of pathogenic Cryptococcus species and closely related saprobic taxa in the Tremellales. Eukaryot. Cell 8: 353-361, 2009.

Facultative intracellular pathogen RefFeldmesser M, et al. Cryptococcus neoformans is a facultative intracellular pathogen in murine pulmonary infection. Infect. Immun. 68: 4225-4237, 2000. PubMed: 10858240

Genome sequencing strain (Broad Institute, USA). RefHeitman J, et al. The Cryptococcus neoformans genome sequencing project. Mycopathologia 148: 1-7, 1999.  

Morphology After 8 days on YM agar at 30°C, colony is cream-colored, smooth, mucoid. Cells globose or subglobose, single or with bud, pseudohyphae not observed.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 324: Malt extract agar
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCAGTAGAGAATATTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGGGGAATGTAGCACTCTTCGGAGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC

Morphology After 8 days on YM agar at 30°C, colony is cream-colored, smooth, mucoid. Cells globose or subglobose, single or with bud, pseudohyphae not observed.
Name of Depositor PR Williamson
Special Collection NCRR Contract
Chain of Custody
ATCC <-- PR Williamson <-- JR Perfect
Isolation
Patient with Hodgkin's disease, New York
Cross References

Nucleotide (GenBank) : AF254790 Filobasidiella neoformans var. neoformans vacuolar (H+)-ATPase

Nucleotide (GenBank) : AF098972 phosphatidylinositol 3-kinase TOR1 (TOR1), complete coding sequence

Nucleotide (GenBank) : AF097888 macrolide-binding protein FKBP12 (FRR1) gene, complete coding sequence

Nucleotide (GenBank) : AF097889 macrolide-binding protein FKBP12 (FRR1) mRNA, complete coding sequence

Nucleotide (GenBank) : AACO02000000 Cryptococcus neoformans var. grubii H99, whole genome shotgun sequencing project.

References

Williamson PR, et al. Melanin biosynthesis in Cryptococcus neoformans. J. Bacteriol. 180: 1570-1572, 1998. PubMed: 9515929

Feldmesser M, et al. Cryptococcus neoformans is a facultative intracellular pathogen in murine pulmonary infection. Infect. Immun. 68: 4225-4237, 2000. PubMed: 10858240

del Poeta M, et al. Cryptococcus neoformans differential gene expression detected in vitro and in vivo with green fluorescent protein. Infect. Immun. 67: 1812-1820, 1999. PubMed: 10085022

Franzot SP, et al. Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840, 1999. PubMed: 9986871

Cruz MC, et al. Rapamycin antifungal action is mediated via conserved complexes with FKBP12 and TOR kinase homologs in Cryptococcus neoformans. Mol. Cell. Biol. 19: 4101-4112, 1999. PubMed: 10330150

Heitman J, et al. The Cryptococcus neoformans genome sequencing project. Mycopathologia 148: 1-7, 1999.

Peter R Williamson, personal communication

Findley K, et al. Phylogeny and phenotypic characterization of pathogenic Cryptococcus species and closely related saprobic taxa in the Tremellales. Eukaryot. Cell 8: 353-361, 2009.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Ding C, et al. The copper regulon of the human fungal pathogen Cryptococcus neoformans H99. Mol. Microbiol. 81: 1560-1576, 2011. PubMed: 21819456

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

Type strain of Cryptococcus neoformans var. grubii

Williamson PR, et al. Melanin biosynthesis in Cryptococcus neoformans. J. Bacteriol. 180: 1570-1572, 1998. PubMed: 9515929

Franzot SP, et al. Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840, 1999. PubMed: 9986871

Peter R Williamson, personal communication

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation