Malassezia pachydermatis (Wiedman) Dodge, anamorph (ATCC® 14522)

Strain Designations: CBS 1879 [238 Shesis, CCRC 21676, IFO 10064, NRRL Y-17165]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Pityrosporum canis Gustafson, anamorph
Strain Designations CBS 1879 [238 Shesis, CCRC 21676, IFO 10064, NRRL Y-17165]
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology After 15 days on Emmons’ modification of Sabouraud’s medium at 37°C, colonies are cream-colored, smooth, and soft. Yeast cells are ovoid, single, in pairs or clusters.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ATCGTAACAAGGTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAATTTGTAGGGCCTGCCATACGGATGCGCAAGCGTCTCTGGCGCCCAACCCACTATACATCCACAAACCCGTGTGCACTTGTGTTGCTTTGGCCTGTATGGGCGAGCGCACGCATTCAAACAAACTCGTATGGTTGTATGTACGTTGTAAACGTTGGACCGTCACTGGCCAACAAACTTTATACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCGCGAATTCTCCCACCCCAAACGGTTGCCGAAAGGTACTGTGCGGCGGAGGGGTTGGATGGGTGCTACTGCCTGTGGTGGGGAAACTACAACAGGCTCGCCCGAAATGCATTAGCGCCTCAGGACACATTCGCTACTGCTCTACAAAAGGAAGAGCAGCGAAGCGTATGGGGGGGAAAACCACCACCGGTTATTCCAAACCTCGCCTGACTGTTTTTGCGCGCATGGCATGATACGTCATTTGCTGTGTTGCGTAGGTTGGTGCGTGGGACTGTGTGAGTGCCTCTAGAGCTTTGAGAAGTGTGTTTCGTGTGCTACGAACTGAAAAAGTACATTCCTTTTTTTCAATTCTGGTCTCAAATCAGGTAGGATCACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene.

GTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAGAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGTGGCGCTATGGACAAGTCCCTTGGAACAGGGCATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGCTGTACCATGCTTTGTGATACACGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCGCTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTTGCTTTTGCTTGGTGTATTTCTCGGTAGCAAGCCAGCATTGGTTCGAGTCGTCGGAGAAGGGTATGAGAAATGTGGCATCCTCGGATGTGTTATAGACTTGTACTGGATACGACGATTTGGATCAAGGAACGCAGTGTGCCTCTGGCGGGTCTTCGGACACCTTCACACTTAGGATGCTGGCGTAATGGCTTTAAGCGGCCCGTCTTG

Morphology After 15 days on Emmons’ modification of Sabouraud’s medium at 37°C, colonies are cream-colored, smooth, and soft. Yeast cells are ovoid, single, in pairs or clusters.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- BA Gustafson 238 Shesis
Isolation
Otitis externa in a dog, Sweden
Cross References

Nucleotide (GenBank) : AF063215 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : AJ249952 26S ribosomal RNA gene, partial sequence

References

. The yeasts: a taxonomic study. 2nd ed.Amsterdam: North-Holland; 1970.

Guillot J, Gueho E. The diversity of Malassezia yeasts confirmed by rRNA sequence and nuclear DNA comparisons. Antonie van Leeuwenhoek 67: 297-314, 1995. PubMed: 7778898

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation