Candida albicans (Robin) Berkhout, anamorph (ATCC® 11651™)

Strain Designations: 171D  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations 171D
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Comments
Effects of yeast cells on virulence for mice
Morphology and physiology of strain sectors
response to light
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

CTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGAAACACGGA
Name of Depositor GH Scherr
Chain of Custody
ATCC <-- GH Scherr <-- M. Hotchkiss <-- F. Spindle
Isolation
lung pus, Virginia
Cross References

Nucleotide (GenBank) : J04230 C.albicans thymidylate synthase (Ts) gene, complete cds.

References

. . Mycopathol. Mycol. Appl. 6: 260-289, 1953.

Saltarelli CG, Coppola CP. Effect of light on growth and metabolite synthesis in Candida albicans. Mycologia 71: 773-785, 1979.

Saltarelli CG. Morphological and physiological variations between sectors isolated from giant colonies of Candida albicans and C. stellatoidea. Mycopathol. Mycol. Appl. 34: 209-220, 1968.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS
Other Documentation
Other Document
Microbial Characterization Data