Aspergillus niger van Tieghem, anamorph (ATCC® 1015)

Strain Designations: A1144 3528.7 [ATCC 10582, CBS 113.46, IMI 31821, LSHB Ac4, NCTC 3858a, NRRL 1278, NRRL 328, NRRL 350, NRRL 511, TC 167]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations A1144 3528.7 [ATCC 10582, CBS 113.46, IMI 31821, LSHB Ac4, NCTC 3858a, NRRL 1278, NRRL 328, NRRL 350, NRRL 511, TC 167]
Application
degrades apple pomace
produces citric acid citrate
produces glucoamylase
produces: citric acid from apple pomace
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Intended Use
Genome Sequenced Strain

Yes

Comments
Antigens
Parent of ATCC 11414
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC

Name of Depositor C Thom
Chain of Custody
ATCC <-- C Thom <-- Mellon Inst.
Cross References

Nucleotide (GenBank) : JX535496 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX535499 D1/D2 region of 28S region

Nucleotide (GenBank) : X52521 Aspergillus niger bphA gene for benzoate-para-hydroxylase

Nucleotide (GenBank) : ACJE01000000 Aspergillus niger ATCC 1015, whole genome shotgun sequencing project

References

van Verseveld HW, et al. Determination of the maximum product yield from glucoamylase-producing Aspergillus niger grown in the recycling fermentor. Antonie van Leeuwenhoek 60: 313-323, 1991. PubMed: 1807200

Kim SJ, Chaparas SD. Characterization of antigens from Aspergillus fumigatus. III. Comparison of antigenic relationships of clinically important aspergilli. Am. Rev. Respir. Dis. 120: 1297-1303, 1979. PubMed: 92906

Metwally M. Glucoamylase production in continuous cultures of Aspergillus niger with special emphasis on growth parameters. World J. Microbiol. Biotechnol. 14: 113-118, 1998.

Hang YD, Woodams EE. Apple pomace: a potential substrate for citric acid production by Aspergillus niger. Biotechnol. Lett. 6: 763-764, 1984.

Currie JN. The citric acid fermentation of Aspergillus niger. J. Biol. Chem. 31: 15-37, 1917.

Andersen MR, et al. Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88. Genome Res. 21: 885-897, 2011. PubMed: 21543515

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation