Fusarium solani (Martius) Saccardo, anamorph (ATCC® MYA-3636™)

Alternate State: Nectria haematococca Berkeley et Broome, teleomorph  /  Strain Designations: FS1  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations FS1
Alternate State Nectria haematococca Berkeley et Broome, teleomorph
Application
antifungal susceptibility testing
Biosafety Level 1
Product Format frozen
Type Strain no
Morphology Colonies growing rapidly forming white aerial mycelium, green to bluish-brown when sporodochia are present; reverse usually colorless. Monophialides with a rather distinct collarette. Macroconidia usually moderately curved, with short, blunt apical and indistinctly pedicellate basal cells, mostly 3-septate, 28-42 × 4-6 µm. Microconidia usually abundant, 8-16 × 2.0-4.5 µm. Chlamydospores common.
Medium ATCC® Medium 2555: Carnation Leave Agar
Growth Conditions
Temperature: 25.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
TATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATTCGAGGTCAACATTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGCCGCTCTCCAGTTGCGAGGTGTTAGCTACTACGCAATGGAAGCTGCGGCGGGACCGCCACTGTATTTGGGGGACGGCGTTGTGCCCGCAGGGGGCTTCCGCCGATCCCCAACGCCAGGCCCGGGGGCCTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTGTTTACTCAGAAGAAACATTATAGAAACAGAGTTAGGGGGTCCTCTGGCGGGGGCGGCCCGTGTTACGGGGCCGTCTGTTCCCGCCGAGGCAACGTTATAGGTATGTCACAGGGGGATGA
Morphology Colonies growing rapidly forming white aerial mycelium, green to bluish-brown when sporodochia are present; reverse usually colorless. Monophialides with a rather distinct collarette. Macroconidia usually moderately curved, with short, blunt apical and indistinctly pedicellate basal cells, mostly 3-septate, 28-42 × 4-6 µm. Microconidia usually abundant, 8-16 × 2.0-4.5 µm. Chlamydospores common.
Name of Depositor TJ Walsh
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- TJ Walsh
Isolation
human
References

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS
Other Documentation
Other Document
Microbial Characterization Data