Aspergillus flavus Link, anamorph (ATCC® 9643)

Strain Designations: SN 3 [Aust. Mycol. Panel 3, CBS 131.61, DSM 1959, Harvard 997, IFO 6343, IMI 91856, NRRL A-3537, NRRL A-5244, QM 380, RIB 1403]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations SN 3 [Aust. Mycol. Panel 3, CBS 131.61, DSM 1959, Harvard 997, IFO 6343, IMI 91856, NRRL A-3537, NRRL A-5244, QM 380, RIB 1403]
Application
Assay of wood preservative compounds
Bacterial resistance testing adhesives
Deacylates
Fungus resistance testing
Fungus resistance testing adhesives
Fungus resistance testing airborne equipment
Fungus resistance testing aircraft transmissions
Fungus resistance testing automotive components
Fungus resistance testing cork
Fungus resistance testing electrical insulation
Fungus resistance testing packing materials
Fungus resistance testing varnish
Fungus resistance testing wax
Produces blasticidin S deaminase
Testing fungicides on lumber
Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
This strain is recommended by ATCC for use in the tests described in RF31871 where only the taxon is specified.
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Comments
Aflatoxin not produced
Morphology After 6 says on Potato dextrose medium at 25°C, colony is low, white, cottony, becoming green with sporulation. Conidial heads radiate; stipes hyaline, smooth-walled; vesicles globose with metulae or phialides covering nearly the entire surface of the vesicle; variably seriate. Conidia subglobose, smooth-walled, green.
Medium ATCC® Medium 312: Czapek's agar
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 307: Cornmeal agar
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAG

Morphology After 6 says on Potato dextrose medium at 25°C, colony is low, white, cottony, becoming green with sporulation. Conidial heads radiate; stipes hyaline, smooth-walled; vesicles globose with metulae or phialides covering nearly the entire surface of the vesicle; variably seriate. Conidia subglobose, smooth-walled, green.
Name of Depositor WH Weston
Isolation
Shoe sole, New Guinea
References

Kumeda Y, Asao T. Single-strand conformation polymorphism analysis of PCR-amplified ribosomal DNA internal transcribed spacers to differentiate species of Aspergillus section Flavi. Appl. Environ. Microbiol. 62: 2947-2952, 1996. PubMed: 8702288

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C.

U.S. Department of Defense Insulation, electrical, synthetic-resin composition, nonrigid. Washington, DC:US Department of Defense;Military Specification MIL-I-631D, 1961

U.S. Department of Defense Wax, impregnating, waterproofing, for laminated paper tubes for small arms ammunition. Washington, DC:US Department of Defense;Military Specification MIL-W-10885B, 1956

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Schmidt E, French DW. Two-day mold testing using a contact agar method. For. Prod. J. 29: 39-42, 1979.

Yamaguchi I, et al. Isolation and purification of blasticidin S deaminase from Aspergillus terreus. J. Antibiot. 28: 7-14, 1975. PubMed: 236272

Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1.

Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1.

Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00.

Adhesives for load-bearing timber structures --- Casein adhesives --- Classification and performance requirements, Annex B. London, UK:British Standards Institution;British Standard BS EN 12436:2002.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation