Trichophyton mentagrophytes (Robin) Blanchard, anamorph (ATCC® 9533)

Alternate State: Arthroderma benhamiae Ajello et Cheng, teleomorph, Arthroderma vanbreuseghemii Takashio, teleomorph  /  Strain Designations: 640 [Emmons 640, NIH 640, QM 248]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Trichophyton interdigitale Priestley, anamorph
Strain Designations 640 [Emmons 640, NIH 640, QM 248]
Alternate State Arthroderma benhamiae Ajello et Cheng, teleomorph, Arthroderma vanbreuseghemii Takashio, teleomorph
Application
Efficacy testing
Media testing
Testing antimicrobial agent
Testing disinfectants
Biomedical Research and Development Material
Food testing
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Comments
The ITS sequence comparison indicates that this strain is Trichophyton interdigitale (Trichophyton mentagrophytes var. interdigitale).
Morphology After 3 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, dense, velutinous; reverse orange. Microconidia abundant, hyaline, tear-drop shaped, formed alongside the hyphae. Macroconidia cigar shaped, hyaline, smooth-walled, 2-3 septate.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence. GenBank accession number: KC146353

AAGGATCATTAGCGCGCAGGCCGGGAGGCTGGCCCCCCACGATAGGGCCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACATTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTTTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT

Morphology After 3 days on Emmons’ modification of Sabouraud’s agar at 25°C, colony is white, flat, dense, velutinous; reverse orange. Microconidia abundant, hyaline, tear-drop shaped, formed alongside the hyphae. Macroconidia cigar shaped, hyaline, smooth-walled, 2-3 septate.
Name of Depositor CW Emmons
Special Collection ATCC
Isolation
Clinical specimen - human, 1943
Cross References

Nucleotide (GenBank) : KC146353 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

References

AOAC International Fungicidal activity of disinfectants. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 955.17.

Quality Control for Commercially Prepared Microbiological Culture Media; Approved Standard - 3rd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M22-A3.

US General Services Administration Disinfectant, general purpose (liquid phenolic type). Washington, DC:US General Services Administration;Commercial Item Description A-A-1438A, 1997

US General Services Administration Disinfectant-detergent, general purpose (phenolic type). Washington, DC:US General Services Administration;Commercial Item Description A-A-1439A, 1998

US General Services Administration Disinfectant-detergent, general purpose (iodophor). Washington, DC:US General Services Administration;Commercial Item Description A-A-1440, 1981

US General Services Administration Disinfectant, general purpose (quaternary ammonium compound). Washington, DC:US General Services Administration;Commercial Item Description A-A-1441B, 2005

US General Services Administration Disinfectant-detergent, general purpose (quaternary ammonium compound). Washington, DC:US General Services Administration;Commercial Item Description A-A-1443A, 1998

AOAC International Germicidal spray products as disinfectants. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 961.02.

human tinea pedis

Standard Quantitative Carrier Test Method to Evaluate the Bactericidal, Fungicidal, Mycobactericidal, and Sporicidal Potencies of Liquid Chemical Microbicides. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2111-05.

Standard Quantitative Disk Carrier Test Method for Determining the Bactericidal, Virucidal, Fungicidal, Mycobactericidal and Sporicidal Activities of Liquid Chemical Germicides. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2197-02.

Standard Practice for Evaluation of Pre-saturated or Impregnated Towelettes for Hard Surface Disinfection . West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2362-04.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation