Candida glabrata (Anderson) Meyer et Yarrow (ATCC® 90030)

Strain Designations: NCCLS 84  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Torulopsis glabrata (Anderson) Lodder et de Vries
Strain Designations NCCLS 84
Application
Susceptibility testing antifungal agents
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Medium Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

TTAAAGACGTCTGTCTGCCCAGCACGCACAAAACACTCACATATCCCTCCCTAGATCAACACCGAGTTGGTAAAACCTAATACAGTATTAACCCCCGCCGCTCGCGCAAACGAGCAGCAGATTAATAGAGAAGCTTGCGCTCGTGTCCCACATACTGATATGGCCTACAATTTCAAGTTAACTCAAAAACGAGAGTATCACTCACTACCAAACACAACGTGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCATTGTTGAAAGTTTTGAAGTTGTTTTCTACTAAAAGAAATCTTGTGTTGACTGAATTAGTTTAAAAAAATATTTGTTTGTGTTTGCATCCACTGGGAGAACTCCCCCCCGAAAGAGAGCGTTCCCCCAACGAACAAAAGAATAGTAGTAAAGTAAACTCCACTGTGTGTAGTAATTAGAAAGTGTCGAGTCGTGTGATAAAACACCTCCTTTGGAATAGAGAGATCCACGCACACTCCCAGGTCTTTGTCGGCTCCCTCCCCCCACTGCAGAACACCCACCAACCGCGCACTTAAGCGCAGGCAGGAGAAATGGCATTCACAGCAGAGAAAATATTTTAGGAGCCTCCTGAGTGTCTACACTGGTCCTCCCCAGAGATGTCTCT


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGTACCACTTTGGGACTGTACTTTGCCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGGCGAGGGTGTCAGTTCTTTGTAAAGGGTGCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTTGCCTCTCGTGGGCTTGGGACTCTCGCAGCTCACTGGGCCAGCATCGGTTTTGGCGGCCGGAAAAAACCTAGGGAATGTGGCTCTGCGCCTCGGTGTAGAGTGTTATAGCCCTGGGGAATACGGCCAGCCGGGACCGAGGACTGCGATACTTGTTATCTAGGATGCTGGCATAATGGTTATATGCCG

Name of Depositor MA Pfaller
Isolation
Blood, Iowa
Cross References

Nucleotide (GenBank) : AJ289782 Candida glabrata partial ORF1 for putative mitochondrial protein.

References

Espinel-Ingroff A, et al. Collaborative comparison of broth macrodilution and microdilution antifungal susceptibility tests. J. Clin. Microbiol. 30: 3138-3145, 1992. PubMed: 1452697

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation