Trametes versicolor (Linnaeus : Fries) Lloyd, teleomorph (ATCC® 62976)

Strain Designations: FES 1030 [IFO 30340, Ps 4a]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Trametes versicolor (Linnaeus : Fries) Pilat, teleomorph
Strain Designations FES 1030 [IFO 30340, Ps 4a]
Application
testing wood preservatives
testing wood for natural resistance to decay
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 12 days on Malt agar medium at 25°C, colony is white, flat, powdery or cottony; reverse uncolored. Clamp connections present.
Medium Medium 323: Malt agar medium
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCTTTGCTTCGGCTTAGTGCACTTTCCGGTTGACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGAGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCCTTATGGCTGGGGTTCGCCCACATTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGAC

Morphology After 12 days on Malt agar medium at 25°C, colony is white, flat, powdery or cottony; reverse uncolored. Clamp connections present.
Name of Depositor Y Abe
Chain of Custody
ATCC <-- Y Abe <-- K Aoshima Ps 4a
Isolation
Quercus serrata, Japan
References

Test methods for determining the effectiveness of wood preservatives and their performance requirements. Tokyo, Japan:Japanese Standards Association;JIS K 1571, 2004

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation