Kloeckera japonica Saito et Ohtani, anamorph (ATCC® 58370)

Alternate State: Hanseniaspora valbyensis Klocker, teleomorph  /  Strain Designations: NRRL Y-1382 [CBS 281]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations NRRL Y-1382 [CBS 281]
Alternate State Hanseniaspora valbyensis Klocker, teleomorph
Biosafety Level 1
Product Format freeze-dried
Type Strain yes RefSaito K. On some fermentative yeasts isolated from sap exuded from tree trunks. J. Ferment. Technol. 9: 6-11, 1931.
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 25.0°C
Sequenced Data
  

   18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GCGGAAGGATCATTAGATTGAATTATCATTTTGTTGCTCGAGTTCTTTTAAGATCTTTTACAATTTAAATGGGTTGTCTTTGTTTGAGATGTGCGCTTAATTGCGCTGCTTATTCAGAGGCTCTCAGTAGAAGTAATTTTTAATTGAATCTCAGTCAACTACTACACACAGTGGAGTTTTCTACTTAATTCTTTCTACTTTGGGTCGCAAGATCCAAGGTAAAAACAAACACAAACAATTTTTTTTATTATAATTTTTTAAGCTAAACCAAAATTCCTAACGGAAATTTTAAATAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCGAATTGCGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTGAATTTTTGAACGCACATTGCGTCCTCAGGTATTCCTGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAAAGAATATTTTATTATTTTTTTGGTAGTGAGCGATACTCAGGGTTAGCTTGAAATTGAAGATTTTTGTAATCTTTAATAATTCAACACTTAGCTTCTTTGGAGACGCTGTTCTCGCTGTGATGTATTTATGGATTCGTCTATTTTTTACATTTGCAAGGGATTCGGTAAAGTACCTTAGGCAAAGAGTTGTTTTTAATACTCATCAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATA

Name of Depositor NRRL
Isolation
tree exudate, Japan
References

Saito K. On some fermentative yeasts isolated from sap exuded from tree trunks. J. Ferment. Technol. 9: 6-11, 1931.

type strain

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Saito K. On some fermentative yeasts isolated from sap exuded from tree trunks. J. Ferment. Technol. 9: 6-11, 1931.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation