Geotrichum sp. (ATCC® 34614)

Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Geotrichum candidum Link : Persoon, anamorph
Application
Degrades sauerkraut brine
Produces acetoin dehydrogenase diacetyl reductase
Produces lactate dehydrogenase
Produces lipase
Produces polygalacturonase endopolygalacturonase, pectinase
Quality control strain
Produces lipases I and II
Produces type A lipase
Produces extracellular lipase from sauerkraut brine
Produces acetoin dehydrogenase from sauerkraut brine
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Crystal structure of lipase
cDNA clone of lipase genes
Morphology On YM medium at 25°C after 3 days, colonies white to dingy white, finely hairy (able to see the branching hyphae in the texture), dense, raised. Hyphae hyaline, guttulate. Arthroconidia rectangular to cubic, hyaline, smooth, 6-7.5 X 3-3.75 µm. Yeast cells subglobose to oval, hyaline, smooth, larger cells 9-12 X 4.5-8.25 µm, smaller cells 5.25-6 X 4.5-5.25 µm.
Medium Medium 325: Malt extract agar (Blakeslee's formula)
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCAAAACAAAAATAATCAAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCTTTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAAATTCCTTCTAAAGCTAAATATTGACGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTCGGCAYAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTWGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCG

Morphology On YM medium at 25°C after 3 days, colonies white to dingy white, finely hairy (able to see the branching hyphae in the texture), dense, raised. Hyphae hyaline, guttulate. Arthroconidia rectangular to cubic, hyaline, smooth, 6-7.5 X 3-3.75 µm. Yeast cells subglobose to oval, hyaline, smooth, larger cells 9-12 X 4.5-8.25 µm, smaller cells 5.25-6 X 4.5-5.25 µm.
Name of Depositor M Iwai
Isolation
Clotted carrot, Japan
Cross References

Nucleotide (GenBank) : E02497 cDNA encoding Geotrichum candidum lipase.

Nucleotide (GenBank) : U02622 Geotrichum candidum ATCC 34614 lipase gene, partial cds.

Nucleotide (GenBank) : U26858 Galactomyces geotrichum isolate g56 28S rRNA gene, partial

Nucleotide (GenBank) : U02541 Geotrichum candidum ATCC 34614 lipase II gene, partial cds.

References

. . Food Chem. 45: 15-17, 1992.

Hang YD, Woodams EE. Production and characterization of polygalacturonase from Geotrichum candidum. World J. Microbiol. Biotechnol. 8: 480-482, 1992.

Jacobsen T, Poulsen OM. Comparison of lipases from different strains of the fungus Geotrichum candidum. Biochim. Biophys. Acta 1257: 96-102, 1995. PubMed: 7619863

Shimada Y, et al. cDNA molecular cloning of Geotrichum candidum lipase. J. Biochem. 106: 383-388, 1989. PubMed: 2481674

Nagao T, et al. Cloning and sequencing of two chromosomal lipase genes from Geotrichum candidum. J. Biochem. 113: 776-780, 1993. PubMed: 8370674

Schrag JD, et al. Multiple crystal forms of lipases from Geotrichum candidum. J. Mol. Biol. 220: 541-543, 1991. PubMed: 1870119

. . Bioresour. Technol. 43: 181-183, 1993.

Hata Y, et al. Low resolution crystal structure of lipase from Geotrichum candidum (ATCC34614). J. Biochem. 86: 1821-1827, 1979. PubMed: 575138

Sugihara A, et al. Separation and characterization of two molecular forms of Geotrichum candidum lipase. J. Biochem. 107: 426-430, 1990. PubMed: 2341377

Shimada Y, et al. cDNA cloning and characterization of Geotrichum candidum lipase II. J. Biochem. 107: 703-707, 1990. PubMed: 2398037

Catoni E, et al. Overexpression of lipase A and B of Geotrichum candidum in Pichia pastoris: high-level production and some properties of functional expressed lipase B. Biotechnol. Tech. 11: 689-695, 1997.

Iwai M, et al. Lipid requirement for the lipase production by Geotrichum candidum Link. Agric. Biol. Chem. 37: 929-931, 1973.

Iwai M, et al. Synthesis of terpene alcohol esters by lipase. Agric. Biol. Chem. 44: 2731-2732, 1980.

Hang YD, Woodams EE. Lipase production by Geotrichum candidum from sauerkraut brine. World J. Microbiol. Biotechnol. 6: 418-421, 1990.

FF MicroPlate. Biolog.

YT MicroPlate QC Set. Biolog.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation