Candida glabrata (Anderson) Meyer et Yarrow, anamorph (ATCC® 2001)

Strain Designations: CBS 138  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Torulopsis glabrata (Anderson) Lodder et de Vries, anamorph
Strain Designations CBS 138
Application
Control strain for identification
Mapping of mitochondrial DNA
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain yes
Genome Sequenced Strain

Yes

Comments
MIC of 2-hydroxychalcone, 75 mcg/ml
Genome sequencing strain (completed by Genolevures Consortium, France).
Sequenced mitochondrial genome.
Morphology Colonies after 3 days on YM medium at 25°C are white, smooth, butyrous and entire. Cells are subglobose to ovoidal, single and in pairs pseudohyphae are absent.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TAATTGATTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCTATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACATTGTGTTTGGTAGTGAGTGATACTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATAAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAG


Large subunit ribosomal RNA gene, partial sequence.

CAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGTACCACTTTGGGACTGTACTTTGCCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGGCGAGGGTGTCAGTTCTTTGTAAAGGGTGCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTTGCCTCTCGTGGGCTTGGGACTCTCGCAGCTCACTGGGCCAGCATCGGTTTTGGCGGCCGGAAAAAACCTAGGGAATGTGGCTCTGCGCCTCGGTGTAGAGTGTTATAGCCCTGGGGAATACGGCCAGTCGGGACCGAGGACTGCGATACTTGTTATCTAGGATG

Morphology Colonies after 3 days on YM medium at 25°C are white, smooth, butyrous and entire. Cells are subglobose to ovoidal, single and in pairs pseudohyphae are absent.
Name of Depositor CBS
Isolation
Feces
Cross References

Nucleotide (GenBank) : JQ070075 ITS including 5.8S rRNA gene

References

. . J. Infect. Dis. 1: 98, 1917.

. . Mycopathol. Mycol. Appl. 1: 0..

Sato M, et al. Growth inhibitory properties of chalcones to Candida. Lett. Appl. Microbiol. 18: 53-55, 1994.

. . Curr. Genet. 1: 209-217, 1980.

Maiwald M, et al. Rapid presumptive identification of medically relevant yeasts to the species level by polymerase chain reaction and restriction enzyme analysis. J. Med. Vet. Mycol. 32: 115-122, 1994. PubMed: 8064542

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

Nakayama H, et al. Depletion of the squalene synthase (ERG9) gene does not impair growth of Candida glabrata in mice. Antimicrob. Agents Chemother. 44: 2411-2418, 2000. PubMed: 10952588

Abbreviated Identification of Bacteria and Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M35-A2.

Dujon B, et al. Genome evolution in yeasts. Nature 430: 35-44, 2004.

Koszul R, et al. The complete mitochondrial genome sequence of the pathogenic yeast Candida (Torulopsis) glabrata. FEBS Lett. 534: 39-48, 2003. PubMed: 12527359

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

RapID Yeast PLUS QC Set. Remel.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation