Aspergillus versicolor (Vuillemin) Tiraboschi, anamorph (ATCC® 11730)

Strain Designations: QM 432 [ATCC 16020, CBS 245.65, DSM 1943, DSM 63301, IFO 30338, IMI 45554, MIT-1c]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations QM 432 [ATCC 16020, CBS 245.65, DSM 1943, DSM 63301, IFO 30338, IMI 45554, MIT-1c]
Application
Fungus resistance testing
Fungus resistance testing adhesives
Fungus resistance testing airborne equipment
Fungus resistance testing automotive components
Produces acetyl-xylan esterase
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAAAATGGTTGGACGTCGGCTGGCGCCCGGCCGGCCCTAAATCGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACACGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGGGGGACGACGACCCAACACACAAGCCGGGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCAGTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACTGATTTTATATTCAGACTCAGACTGCATCACTCTCAGGCATGAAGTTCAGTAGTCCCCGGCGGCTCGCCCCCGAGAGGGCTCCCCGCCGAAGCAACAGTGTTAGGTAGTCACGGG

Name of Depositor QM
Chain of Custody
ATCC <-- QM <-- MIT-1c
Isolation
Cellophane gas mask, India
References

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C.

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Khan AW, et al. Comparison of natural hemicellulose and chemically acetylated xylan as substrates for the determination of acetyl-xylan esterase activity in Aspergilli. Enzyme Microb. Technol. 12: 127-131, 1990.

Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1.

Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1.

Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation