Postia placenta (Fries) Larsen et Lombard, teleomorph (ATCC® 11538_TT)

Strain Designations: Madison 698 [ATCC 44197, Boat-106, CSIRO DFP 7522, FP 94267]  /  Product Format: test tube

Deposited As Poria monticola Murrill, teleomorph
Strain Designations Madison 698 [ATCC 44197, Boat-106, CSIRO DFP 7522, FP 94267]
Application
degrades coal
degrades glycosides
degrades polysaccharides
fungus resistance testing wood
produces endoglucanase
resistant to copper compounds
resistant to zinc compounds
testing wood preservatives
produces extracellular polysaccharide- and glycoside-degrading enzymes
Biosafety Level 1
Product Format test tube
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® no
Comments
Does not degrade cellulose in the absence of wood
Medium Medium 200: YM agar or YM broth
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTTTGAAAGGGGTTGTAGCTGGCCTTTTAGGAGGCATGTGCACACCCTGCTCTTCCATTCTTACACCTGTGCACACTTGTAGGTCGGTTTGAGCGGTTCTCTCTAACGGGGGATGCTGTTTGGCCTTCCTATGTTTTATAACAAACTCTGTAATGTCATAGAATGTCATCGCGTATAACGCATTATAATATAACTTTCAGCAACGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTGGGTATTCCGAGGAGCATGCCGTTTGAGTGTCATGGAATTCTCAACCCTCTTATCCTTGTGGTGAGATTGGGTTGGATTTGGAGGTTTATGCTGGCTTGTAATGAGTCGGCTCCTCTTGAATGCATTAGCTTGGACCTTTGCGGACCACTTTTCGGTGTGATAATTGTCTACGCCGTGGGCTGTGATGCTGTTTAACATGCTTCGGTGTGTTGGGGTTCTGCTTCTAATGGTCCCTT

Name of Depositor FF Lombard
Chain of Custody ATCC <-- FF Lombard <-- RW Davidson Boat-106
Isolation Douglas-fir boat timbers, Maryland
References

Cohen MS, Gabriele PD. Degradation of coal by the fungi Polyporus versicolor and Poria monticola. Appl. Environ. Microbiol. 44: 23-27, 1982.

Wolter KE, et al. A unique polysaccharide- and glycoside-degrading enzyme complex from the wood-decay fungus Poria placenta. Biochem. Biophys. Res. Commun. 97: 1499-1504, 1980. PubMed: 7213375

. . FEMS Microbiol. Lett. 127: 73-78, 1995.

ASTM International Standard Test Method for Wood Preservatives by Laboratory Soil-block Cultures. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 1413-07.

AWPA Standard method of testing wood preservatives by laboratory soil-block cultures. Birmingham, AL:American Wood-Preservers' Association;AWPA E10-06, 2006

Da Costa EW. Comparison of three organic fungicides as light oil solvent preservatives. Holzforschung 33: 65-67, 1979.

Smith RS. Proposed standard method of testing wood preservatives by soil-block cultures and respiration analysis. Proc. Am. Wood Preserv. Assoc. 72: 222-229, 1976.

Highley TL. Can wood-rot fungi degrade cellulose without other wood constituents?. For. Prod. J. 25: 38-39, 1975.

Butcher JA, Preston AF. Toxicity of tertiary amine acetates against basidiomycetes and soft-rot fungi. N.Z. J. For. Sci. 8: 397-402, 1978.

Accelerated laboratory procedure for evaluating the efficacy of diffusible or volatile internal remedial preservatives. Birmingham, AL:American Wood-Preservers' Association;AWPA E15-03, 2006

Standard accelerated laboratory method for testing the efficacy of preservatives against wood decay fungi using compression strength. Birmingham, AL:American Wood-Preservers' Association;AWPA E22-06, 2006