Aspergillus terreus Thom, anamorph (ATCC® 10690)

Strain Designations: QM 82-j [CBS 377.64, DSM 1958, IFO 6346, IMI 321320, IMI 45543, NRRL 571, QM 82J]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations QM 82-j [CBS 377.64, DSM 1958, IFO 6346, IMI 321320, IMI 45543, NRRL 571, QM 82J]
Application
fungus resistance testing
fungus resistance testing paper and paperboard
fungus resistance testing plastics
fungus resistance testing sandbags
fungus resistance testing textiles
produces LL-S88 alpha
produces antiviral agent
produces polyamine oxidase
testing
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Morphology After 5-7 days on Emmons' modification of Sabouraud's agar at 25°C colonies yellowish to cinnamon-brown consisting of dense felt of conidiosphores. Conidial heads in compact columns; stipes smooth-walled, variable in shape, spherical to dome-like. Conidia smooth-walled, globose to subglobose.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTATGGGGCGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCGGGGTTCAGCCGGGCTTCGGCCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTTGTAAACGAC

Morphology After 5-7 days on Emmons' modification of Sabouraud's agar at 25°C colonies yellowish to cinnamon-brown consisting of dense felt of conidiosphores. Conidial heads in compact columns; stipes smooth-walled, variable in shape, spherical to dome-like. Conidia smooth-walled, globose to subglobose.
Name of Depositor QM
Isolation
Haversack, New Guinea
References

Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.

IEC Basic environmental testing procedures: Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 60068-2-10, Part 2, Test J.

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Isobe K, et al. Kinetic properties of fungal polyamine oxidases and their application to differential determination of spermine and spermidine. Agric. Biol. Chem. 44: 2955-2960, 1980.

Isobe K, et al. Crystallization and characterization of polyamine oxidase from Aspergillus terreus. Agric. Biol. Chem. 44: 2749-2751, 1980.

Yamada H, et al. Oxidation of polyamines by fungal enzymes. Agric. Biol. Chem. 44: 2469-2476, 1980.

Environmental testing. Part 2.10: Tests--Test J and guidance: Mould growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 60068.2.10-2003.

Fibre Optic interconnecting divices and passive components --Basic test and measurement procedures--Part 2-16: Tests --Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 1300-2-16, 1995

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation