Penicillium varians Smith, anamorph (ATCC® 10509)

Strain Designations: NRRL 2096 [CBS 386.48, G. Smith LSHB BB91, IFO 6112, IMI 40586, NCTC 4152, QM 7691]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL 2096 [CBS 386.48, G. Smith LSHB BB91, IFO 6112, IMI 40586, NCTC 4152, QM 7691]
Application
fungus resistance testing textiles
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology After 10 days on PDA at 25°C, colony is flat, velutinous to slightly floccose, dull grey. Reverse turning red, with dark green stippling. Penicilli biverticillate on short, pigmented stipes, with long slender phialides. Conidia ellipsoidal to near-cylindrical.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGCGAGCTCTCTGAGCTCAACCTCCCACCCGTGTCGTTTTTTAACACCTGTTGCTTTGGCAGGCCCACTGGGGGTCTCCCCGGTCGCCTGCGGACGCGCTGTCCTCGGGCCTGCGCCTGCCAGAGCACCCCCTGAACTCTGAAGAAGATAGGGCTGTCTGAGTACCTAGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCGCGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCCAAAGGCAGCGGCGACGCCTGTTGGGTCCTCGAGCGCATGGGGCTTTGTCACTCGCTCGGGAGGGACTCGCGGGCGTTGGTCACCACCACCATCTTTTTACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCTTTGAGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGTCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGCGGCCGCGCCCGTGTGAAGCGCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTGTCCACCAGACTCGCCCGGGGAGGCTCAGCCGGCACTTGTGCCGGTGTACTCTTCCTCGGGCGGGCCAGCATCGGTTTGGGCGGCTGGTGAAAGGCCCTGGGAATGTAACACCCTCCGGGGTGCCTTATAGCCCAGGGTGTCATGCGGCCAGCCTGGACCGAGGCCCGCGCTTCGGCGAGGATGCTGGCGTAATGGTGGTCAACGGC

Morphology After 10 days on PDA at 25°C, colony is flat, velutinous to slightly floccose, dull grey. Reverse turning red, with dark green stippling. Penicilli biverticillate on short, pigmented stipes, with long slender phialides. Conidia ellipsoidal to near-cylindrical.
Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- NCTC 4152
Isolation
Cotton yarn, England
References

AATCC Antifungal Activity, Assessment on Textile Materials: Mildew and Rot Resistance of Textile Materials. Research Triangle Park, NC:American Association of Textile Chemists and Colorists;AATCC Test Method 30-2004.

Pitt JI, Samson RA. Species names in current use in the Trichocomaceae (Fungi, Eurotiales). Regnum Veg. 128: 13-57, 1993.

Smith G. Some new species of Penicillium. Trans. Br. Mycol. Soc. 18: 88-91, 1933.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation