Sporidiobolus salmonicolor Fell et Tallman (ATCC® MYA-4550)

Alternate State: Sporobolomyces salmonicolor (Fischer et Brebeck) Kluyver et van Niel  /  Strain Designations: VITEK 301525 [MUCL 51628]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Sporobolomyces salmonicolor
Strain Designations VITEK 301525 [MUCL 51628]
Alternate State Sporobolomyces salmonicolor (Fischer et Brebeck) Kluyver et van Niel
Application
quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Quality control strain for VITEK® 2 Yeast Identification Card (listed as Sporobolomyces salmonicolor).
Sequenced Data
LSU rDNA of MYA-4550

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCGCTTTCGGCGTCCGAGTTGTAATCTCGAGAAGTGTTTTCCGCGTCAGACCGCACACAAGTCTCCTGGAACGGAGCGTCACAGTGGTGAGAACCCAGTACACGGTGCGGATGCCTGATGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTATTCGGAGCTTGCTTCGATTCGCAGGCCCGCATCAGTTTTCCGGGGCGGAAAATCGTAAGGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTTTACTGGATTCGTCCTGGGGGACTGAGGAACGCAGCGTGCTTTTTGCATGGGCTTCGGCCCATCCACGCTTAGGATGCGGGTGGAATGGCTTTAAACGAC


ITS of MYA-4550

TTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATAAACAGGGTGTCCAATTTAACTTGGAGCCCAACCTTCTCACTTTCTAACCCTGTGCATCTGTATCTAACGGTGAGCTGCCTTCGGGTGGCGAGCCTTCACTTTAAAACACCAAGTCTATGAATGTATATAATCATAACTATATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCACTCTCTGGTATTCCGGAGAGTATGTCTGTTGGAGTGTCATGAATTCTTCAACCCCACCGTTTCTTGCAAACGCGTGGGTGCTTGGATTCTGAGCGCTGCTGGCTTCGGCCTAGCTCGTTCGTAATGCATTAGCATCCCGATGACAAGTTTGGATTGACTTGGCGTAATAGACTATTCGCTGAGGAGTAAGTGGCCTTCGGGTTACTGAGCCAACTCGTTTCAGGAAGCTTCTAATCCCTAAAGTCTACCTTTTAGATTAGATCTCCAATCAGGCAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Name of Depositor bioMerieux, Inc.
Special Collection ATCC
Chain of Custody
ATCC <-- bioMerieux, Inc.
Cross References

Nucleotide (GenBank) : FJ914903 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914884 ITS including 5.8S rRNA gene

References

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation