Penicillium citrinum Thom, anamorph (ATCC® 9849)

Strain Designations: [11, CBS 342.61, IFO 6352, IMI 321326, IMI 61272, NRRL 756]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations [11, CBS 342.61, IFO 6352, IMI 321326, IMI 61272, NRRL 756]
Application
fungus resistance testing
fungus resistance testing automotive components
fungus resistance testing paint
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Morphology

Colonies on malt agar at 25°C with slow to moderate growth, velutinous to floccose; mycelium white turning greyish-orange. Conidial masses greyish-turquoise. Conidiophores biverticillate.  Phialides flask-shaped. Conidia spherical to subspherical, smooth-walled or finely roughened, 2.2-3.0 µm diam.

Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCCTCGGGGCCCAACCTCCCACCCGTGTTGCCCGAACCTATGTTGCCTCGGCGGGCCCCGCGCCCGCCGACGGCCCCCCTGAACGCTGTCTGAAGTTGCAGTCTGAGACCTATAACGAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCCCCCCGCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTAGTAGGCCCGGCCGGCGCCAGCCGACCCCCAACCTTTAATTATCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAA

Morphology

Colonies on malt agar at 25°C with slow to moderate growth, velutinous to floccose; mycelium white turning greyish-orange. Conidial masses greyish-turquoise. Conidiophores biverticillate.  Phialides flask-shaped. Conidia spherical to subspherical, smooth-walled or finely roughened, 2.2-3.0 µm diam.

Name of Depositor QM
Chain of Custody
ATCC <<--QM<<--QM 1226
Cross References

Nucleotide (GenBank) : JQ070088 ITS including 5.8S rRNA gene

References

Standard method of evaluating the resistance of wood product surfaces to mold growth. Birmingham, AL:American Wood-Preservers' Association;AWPA E24-06, 2006

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation