Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx, teleomorph (ATCC® 9773)

Alternate State: Candida lipolytica (Harrison) Diddens et Lodder, anamorph  /  Strain Designations: 251 [CBS 2072, IFO 1742, KCM-0232]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Mycoderma lipolytica
Strain Designations 251 [CBS 2072, IFO 1742, KCM-0232]
Alternate State Candida lipolytica (Harrison) Diddens et Lodder, anamorph
Application
control strain for identification
quality control strain
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Comments
Growth factor
Morphology After 3 days on YM agar at 25°C, colonies are white, raised, wrinkled and dull. Cells are ovoid to cylindrical, pseudohyphae abundant and well-differentiated.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTATTGATTTTATCTATTTCTGTGGATTTCTATTCTATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGCATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTTTAAACTCTCAATTATTACGTCATTTCACCTCCTTCATCCGAGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTCGGGCGTTCTCCCCTAACCCTCCACACTGCCACCGACGACATAATCCACCCATTTCAC

Morphology After 3 days on YM agar at 25°C, colonies are white, raised, wrinkled and dull. Cells are ovoid to cylindrical, pseudohyphae abundant and well-differentiated.
Name of Depositor PR Burkholder
References

Burkholder PR, et al. Studies on some growth factors of yeasts. J. Bacteriol. 48: 385-391, 1944.

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

VITEK YBC. bioMerieux.

Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320

RapID Yeast PLUS QC Set. Remel.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation