Cryptococcus uniguttulatus (Wolfram et Zach) Phaff et Fell, anamorph (ATCC® 66033)

Alternate State: Filobasidium uniguttulatum Kwon-Chung, teleomorph  /  Strain Designations: AmMS 234  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations AmMS 234
Alternate State Filobasidium uniguttulatum Kwon-Chung, teleomorph
Application
quality control strain
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 6 days, colonies dingy white to buff, smooth, raised, butyrous to mucoid, margin entire. Cells subglobose to ellipsoidal, smooth, hyaline, 3-5 X 2.5-4.5 µm. Pseudohyphae not observed.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTATTGAATTTAGTTGTCTGGCTTTCGCCGACGACGATATCATTATCCATAACACCTGTGCACTGTTGGATGTTTAATACATCCGTTTTACACTAAACAATATTGTTACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAAACTCTTGTTTTGGATGCAAATCCTTGCTTGAGTTTGGACTTGGGTGTTTGCCGGTGATGAACCGACTCGCCTTAAACATATTAGCTGGACTTGTCTATATGACTGGTTTGACTTGGCATAATAAGTATTTTGCTAAGGACATCTTCGGATGGCCAGTACCTAGGCTCTGTGTCTGCTAACTAAACCATCACTTGGAGTGCATCTTTATGGTGTTGCTTCCTGTGTATACTTTGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAATCTGGTGGCCTCAGGTCATCCGAGTTGTAATCTATAGAAGTGTTTTCCGTGCTGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACTACCAGTGCTCTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGCTCAATGGACTCAGCCGTTCTGCGGTGTATTTCCATTGGGTGGGGTCAACATCAGTTTTGATCGCTGGATAAAGGCAGGAGGAATGTAGCACCCCCGGGTGAACTTATAGCCTCTTGTCACATACAGTGGTTGGGACTGAGGAACGCAGCATGCCTTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 6 days, colonies dingy white to buff, smooth, raised, butyrous to mucoid, margin entire. Cells subglobose to ellipsoidal, smooth, hyaline, 3-5 X 2.5-4.5 µm. Pseudohyphae not observed.
Name of Depositor GJ De Leon
References

MicroScan Yeast ID QC Set. Dade/Siemens.

McTaggart LR, et al. Rapid identification of Cryptococcus neoformans and Cryptococcus gattii by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 49: 3050-3053, 2011. PubMed: 21653762

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation