Candida glabrata (Anderson) Meyer et Yarrow, anamorph (ATCC® 64677)

Strain Designations: LRA 85.10.75  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations LRA 85.10.75
Application
quality control strain
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 4 days on YM agar at 25°C colonies cream color, smooth, dull butyous and entire margins. Cells subglobose to ovoid and occur singly or in pairs.
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATTGATTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCTATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATATGTGAGTGTTCTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGTACCACTTTGGGACTGTACTTTGCCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGGCGAGGGTGTCAGTTCTTTGTAAAGGGTGCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTTGCCTCTCGTGGGCTTGGGACTCTCGCAGCTCACTGGGCCAGCATCGGTTTTGGCGGCCGGAAAAAACCTAGGGAATGTGGCTCTGCGCCTCGGTGTAGAGTGTTATAGCCCTGGGGAATACGGCCAGCCGGGACCGAGGACTGCGATACTTGTTATCTAGGATGCTGGCATAATGGTTATATGCCGC

Morphology After 4 days on YM agar at 25°C colonies cream color, smooth, dull butyous and entire margins. Cells subglobose to ovoid and occur singly or in pairs.
Name of Depositor API System/bioMerieux
References

API ID 32 C. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation