Cryptococcus humicola (Daszewska) Golubev, anamorph (ATCC® 64676™)

Strain Designations: LRA 229.03.85  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Candida humicola (Daszewska) Diddens et Lodder, anamorph
Strain Designations LRA 229.03.85
Application
quality control strain
Biosafety Level 1
Product Format frozen
Type Strain no
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
    18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ACCTGCGGAAGGATCATTAGTGATTGCCCTTAGTGGCTAAAAACTATATCCCAAACACCTGTGAACTGTTGAATCGCGTCTTCGGATGTGATTCTTTTACAAACATTGTGTAATGAACGTCATAACATTATAAACAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGATCTCTCAACCAATAGGGTTTCTTATTGGCTTGGATCTGGGTGTTGCCAGCTTTGTCTGGCTCGCCTTAAAGGAGTTAGCGAGTAAAGCTCTGTCGTCTGGCGTAATAAGTTTCGCTGGTGTAGACAGTGGTGGCGCACGCTTATAATCGCCTTCGGGC
Name of Depositor API System/bioMerieux
Cross References

Nucleotide (GenBank) : GU256753 ITS including 5.8S rRNA gene

References

API ID 32 C. bioMerieux.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS