Trametes versicolor (Linnaeus : Fries) Lloyd, teleomorph (ATCC® 62976)

Strain Designations: FES 1030 [IFO 30340, Ps 4a]  /  Product Format: frozen

Deposited As Trametes versicolor (Linnaeus : Fries) Pilat, teleomorph
Strain Designations FES 1030 [IFO 30340, Ps 4a]
Application
testing wood preservatives
testing wood for natural resistance to decay
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Morphology After 12 days on Malt agar medium at 25°C, colony is white, flat, powdery or cottony; reverse uncolored. Clamp connections present.
Medium Medium 323: Malt agar medium
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCTTTGCTTCGGCTTAGTGCACTTTCCGGTTGACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGAGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCCTTATGGCTGGGGTTCGCCCACATTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGAC

Morphology After 12 days on Malt agar medium at 25°C, colony is white, flat, powdery or cottony; reverse uncolored. Clamp connections present.
Name of Depositor Y Abe
Chain of Custody
ATCC <-- Y Abe <-- K Aoshima Ps 4a
Isolation
Quercus serrata, Japan
References

Test methods for determining the effectiveness of wood preservatives and their performance requirements. Tokyo, Japan:Japanese Standards Association;JIS K 1571, 2004